FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634536_at:

>probe:Drosophila_2:1634536_at:268:397; Interrogation_Position=1069; Antisense; GACAAGGACGCCATCGAGTTGCACG
>probe:Drosophila_2:1634536_at:195:429; Interrogation_Position=1084; Antisense; GAGTTGCACGAGAATTGCCTGCCTC
>probe:Drosophila_2:1634536_at:393:7; Interrogation_Position=1097; Antisense; ATTGCCTGCCTCTGCCAAAGGAGTA
>probe:Drosophila_2:1634536_at:238:661; Interrogation_Position=633; Antisense; TAAACTTCCTTTGCAGTACCGAGTA
>probe:Drosophila_2:1634536_at:175:237; Interrogation_Position=691; Antisense; AATAAGCATTCCTCCGATTTAGCAC
>probe:Drosophila_2:1634536_at:702:183; Interrogation_Position=749; Antisense; AAAATCAACACATTCCGGCAACTCT
>probe:Drosophila_2:1634536_at:180:203; Interrogation_Position=781; Antisense; AACCTGTACACTTTTCGGGTCTGCA
>probe:Drosophila_2:1634536_at:458:537; Interrogation_Position=798; Antisense; GGTCTGCAGCACTTCCAAGGAATTA
>probe:Drosophila_2:1634536_at:308:91; Interrogation_Position=828; Antisense; AGTACCATATTTGCTCCGAGGCGAT
>probe:Drosophila_2:1634536_at:632:55; Interrogation_Position=851; Antisense; ATGATGTCGAAAACACACCCACCTT
>probe:Drosophila_2:1634536_at:496:523; Interrogation_Position=909; Antisense; GGGCTTACTTGAGATCCGAAACATA
>probe:Drosophila_2:1634536_at:332:519; Interrogation_Position=949; Antisense; GTGGATACCCACGATCGAGTGTTCG
>probe:Drosophila_2:1634536_at:52:637; Interrogation_Position=963; Antisense; TCGAGTGTTCGAGTGCCGCCAGTGT
>probe:Drosophila_2:1634536_at:67:237; Interrogation_Position=989; Antisense; AATCCCACTTTGTGGACCGGGTGCA

Paste this into a BLAST search page for me
GACAAGGACGCCATCGAGTTGCACGGAGTTGCACGAGAATTGCCTGCCTCATTGCCTGCCTCTGCCAAAGGAGTATAAACTTCCTTTGCAGTACCGAGTAAATAAGCATTCCTCCGATTTAGCACAAAATCAACACATTCCGGCAACTCTAACCTGTACACTTTTCGGGTCTGCAGGTCTGCAGCACTTCCAAGGAATTAAGTACCATATTTGCTCCGAGGCGATATGATGTCGAAAACACACCCACCTTGGGCTTACTTGAGATCCGAAACATAGTGGATACCCACGATCGAGTGTTCGTCGAGTGTTCGAGTGCCGCCAGTGTAATCCCACTTTGTGGACCGGGTGCA

Full Affymetrix probeset data:

Annotations for 1634536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720