Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634537_at:

>probe:Drosophila_2:1634537_at:607:125; Interrogation_Position=1629; Antisense; AGCCGTTCCCGAGGAGAGTCTGGAT
>probe:Drosophila_2:1634537_at:666:123; Interrogation_Position=1682; Antisense; AGCCCAAGGCGTCCTACGAGGAGAT
>probe:Drosophila_2:1634537_at:186:355; Interrogation_Position=1743; Antisense; GAAAAAGGCTCGTCCGGGATTCCTG
>probe:Drosophila_2:1634537_at:210:523; Interrogation_Position=1807; Antisense; GTGGCCAATCCGCTATACAGGAGCA
>probe:Drosophila_2:1634537_at:445:667; Interrogation_Position=1822; Antisense; TACAGGAGCAATAGTTCCCGCCAGT
>probe:Drosophila_2:1634537_at:217:661; Interrogation_Position=1849; Antisense; TACAGGCCCAAGAAAGGTGTTCCAA
>probe:Drosophila_2:1634537_at:691:121; Interrogation_Position=1877; Antisense; AGCGGGATGATTCCGTTTTCTACAT
>probe:Drosophila_2:1634537_at:33:293; Interrogation_Position=1890; Antisense; CGTTTTCTACATACGGTCCATGGAA
>probe:Drosophila_2:1634537_at:454:537; Interrogation_Position=1961; Antisense; GGTACGATTCACTGAGGGTCATCAA
>probe:Drosophila_2:1634537_at:536:71; Interrogation_Position=1993; Antisense; AGGACCACTTTGCTGAAAGCCGACT
>probe:Drosophila_2:1634537_at:605:629; Interrogation_Position=2026; Antisense; TCCTTGGGATCTGCGGAGCGAAAGT
>probe:Drosophila_2:1634537_at:461:121; Interrogation_Position=2042; Antisense; AGCGAAAGTTGAGCAGCTTCTCCCT
>probe:Drosophila_2:1634537_at:176:445; Interrogation_Position=2122; Antisense; GATGAGTTGCATCCAAGTACCCCGC
>probe:Drosophila_2:1634537_at:70:527; Interrogation_Position=2175; Antisense; GGGCAATTCCCACACAACTGAATCA

Paste this into a BLAST search page for me
AGCCGTTCCCGAGGAGAGTCTGGATAGCCCAAGGCGTCCTACGAGGAGATGAAAAAGGCTCGTCCGGGATTCCTGGTGGCCAATCCGCTATACAGGAGCATACAGGAGCAATAGTTCCCGCCAGTTACAGGCCCAAGAAAGGTGTTCCAAAGCGGGATGATTCCGTTTTCTACATCGTTTTCTACATACGGTCCATGGAAGGTACGATTCACTGAGGGTCATCAAAGGACCACTTTGCTGAAAGCCGACTTCCTTGGGATCTGCGGAGCGAAAGTAGCGAAAGTTGAGCAGCTTCTCCCTGATGAGTTGCATCCAAGTACCCCGCGGGCAATTCCCACACAACTGAATCA

Full Affymetrix probeset data:

Annotations for 1634537_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime