Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634541_a_at:

>probe:Drosophila_2:1634541_a_at:190:677; Interrogation_Position=1014; Antisense; TAGAGGACTGTCGAACCCTGCGAAA
>probe:Drosophila_2:1634541_a_at:436:291; Interrogation_Position=1053; Antisense; CGGGCGGCTATTCATTCTACAATTA
>probe:Drosophila_2:1634541_a_at:94:689; Interrogation_Position=1091; Antisense; TATTCTTAGCCCTTAAAGCACGCAA
>probe:Drosophila_2:1634541_a_at:539:207; Interrogation_Position=1115; Antisense; AAGCTATCTGGCAATTTTTCTGACA
>probe:Drosophila_2:1634541_a_at:636:531; Interrogation_Position=694; Antisense; GGGTGTTATCACGTTGGCATTCCTC
>probe:Drosophila_2:1634541_a_at:307:151; Interrogation_Position=726; Antisense; ACATTAACTACTTTGCCTACCTGAG
>probe:Drosophila_2:1634541_a_at:658:527; Interrogation_Position=754; Antisense; GGGACGGTTCAACTATGCGTTCAAC
>probe:Drosophila_2:1634541_a_at:309:715; Interrogation_Position=824; Antisense; TTCGTTTGGTGTCACTTTGTGCGCA
>probe:Drosophila_2:1634541_a_at:131:349; Interrogation_Position=852; Antisense; GCAGGCCCTACTTTAGAAGGATCCT
>probe:Drosophila_2:1634541_a_at:601:223; Interrogation_Position=868; Antisense; AAGGATCCTGCGTTTCTATATTCTC
>probe:Drosophila_2:1634541_a_at:383:645; Interrogation_Position=882; Antisense; TCTATATTCTCATGGCGTTGGCTAT
>probe:Drosophila_2:1634541_a_at:685:607; Interrogation_Position=906; Antisense; TGAGCCTTGAACTGCTTGACTTTCC
>probe:Drosophila_2:1634541_a_at:551:279; Interrogation_Position=938; Antisense; CTCTGGATTCTGGATGCTCATGCTC
>probe:Drosophila_2:1634541_a_at:661:51; Interrogation_Position=957; Antisense; ATGCTCTGTGGCACTTGGCAACAAT

Paste this into a BLAST search page for me
TAGAGGACTGTCGAACCCTGCGAAACGGGCGGCTATTCATTCTACAATTATATTCTTAGCCCTTAAAGCACGCAAAAGCTATCTGGCAATTTTTCTGACAGGGTGTTATCACGTTGGCATTCCTCACATTAACTACTTTGCCTACCTGAGGGGACGGTTCAACTATGCGTTCAACTTCGTTTGGTGTCACTTTGTGCGCAGCAGGCCCTACTTTAGAAGGATCCTAAGGATCCTGCGTTTCTATATTCTCTCTATATTCTCATGGCGTTGGCTATTGAGCCTTGAACTGCTTGACTTTCCCTCTGGATTCTGGATGCTCATGCTCATGCTCTGTGGCACTTGGCAACAAT

Full Affymetrix probeset data:

Annotations for 1634541_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime