FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634542_at:

>probe:Drosophila_2:1634542_at:352:273; Interrogation_Position=1007; Antisense; CATTTACACATTTGGCTAGCGTTTA
>probe:Drosophila_2:1634542_at:572:495; Interrogation_Position=1043; Antisense; GTCTAGTGAACTTTGTGCTTTCGTT
>probe:Drosophila_2:1634542_at:437:625; Interrogation_Position=497; Antisense; TGCCGCTGAGGAATCTCTTCAAGAA
>probe:Drosophila_2:1634542_at:284:679; Interrogation_Position=550; Antisense; TATGTGTCCTACCACGTGAACCATC
>probe:Drosophila_2:1634542_at:222:299; Interrogation_Position=627; Antisense; CGCTCTCTGCGAACTAGGAAACTTT
>probe:Drosophila_2:1634542_at:204:561; Interrogation_Position=643; Antisense; GGAAACTTTTCGGTGCACATTGCCC
>probe:Drosophila_2:1634542_at:617:219; Interrogation_Position=695; Antisense; AAGTGCGCAAGATTCCGGTGGCCGA
>probe:Drosophila_2:1634542_at:169:207; Interrogation_Position=736; Antisense; AAGCTGTTCGACTTGGTTTCTTGCC
>probe:Drosophila_2:1634542_at:189:279; Interrogation_Position=771; Antisense; CTATGAGATCGGTGCCTGGGTTTCA
>probe:Drosophila_2:1634542_at:285:593; Interrogation_Position=787; Antisense; TGGGTTTCATTCTCTGTGCTGACTT
>probe:Drosophila_2:1634542_at:462:97; Interrogation_Position=854; Antisense; AGATGACCATTTGGGCCTTGGCCAA
>probe:Drosophila_2:1634542_at:50:549; Interrogation_Position=897; Antisense; GGAGTTTAAGGACTACCCTCGCCAG
>probe:Drosophila_2:1634542_at:20:549; Interrogation_Position=955; Antisense; GGATGTGGGTATCCCCATGACGCAT
>probe:Drosophila_2:1634542_at:147:57; Interrogation_Position=971; Antisense; ATGACGCATTCGCTGTATTACCTAT

Paste this into a BLAST search page for me
CATTTACACATTTGGCTAGCGTTTAGTCTAGTGAACTTTGTGCTTTCGTTTGCCGCTGAGGAATCTCTTCAAGAATATGTGTCCTACCACGTGAACCATCCGCTCTCTGCGAACTAGGAAACTTTGGAAACTTTTCGGTGCACATTGCCCAAGTGCGCAAGATTCCGGTGGCCGAAAGCTGTTCGACTTGGTTTCTTGCCCTATGAGATCGGTGCCTGGGTTTCATGGGTTTCATTCTCTGTGCTGACTTAGATGACCATTTGGGCCTTGGCCAAGGAGTTTAAGGACTACCCTCGCCAGGGATGTGGGTATCCCCATGACGCATATGACGCATTCGCTGTATTACCTAT

Full Affymetrix probeset data:

Annotations for 1634542_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720