FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634543_at:

>probe:Drosophila_2:1634543_at:181:435; Interrogation_Position=1658; Antisense; GAGGTGGCCGCAAATGAATCTTTAA
>probe:Drosophila_2:1634543_at:556:419; Interrogation_Position=1694; Antisense; GAGCTAGCTGACCAATCCATTATAG
>probe:Drosophila_2:1634543_at:426:687; Interrogation_Position=1723; Antisense; TATTTTTGGAGAGGACACCCTGCTG
>probe:Drosophila_2:1634543_at:388:511; Interrogation_Position=1761; Antisense; GTGAGAACGACGTGCAGCCCAGTTG
>probe:Drosophila_2:1634543_at:651:93; Interrogation_Position=1781; Antisense; AGTTGCTCAAGCTACGCCAAAAGAA
>probe:Drosophila_2:1634543_at:586:55; Interrogation_Position=1847; Antisense; ATGAGGCGCACTGAGTTGTCCAATC
>probe:Drosophila_2:1634543_at:376:727; Interrogation_Position=1862; Antisense; TTGTCCAATCACTTCGATGGCTGCG
>probe:Drosophila_2:1634543_at:349:187; Interrogation_Position=1936; Antisense; AACAACTGCTTCCTTAACCTCAAAG
>probe:Drosophila_2:1634543_at:467:651; Interrogation_Position=1955; Antisense; TCAAAGGACTCGTCGGGAGCTTCCA
>probe:Drosophila_2:1634543_at:296:35; Interrogation_Position=1981; Antisense; ATCACGCCGCGCTAAATCGAAAGCA
>probe:Drosophila_2:1634543_at:358:551; Interrogation_Position=2050; Antisense; GGAGATCGACAAGCTCAACCTGAGC
>probe:Drosophila_2:1634543_at:380:171; Interrogation_Position=2153; Antisense; AAAGAGACCGTAGGCTGCCCCAGAT
>probe:Drosophila_2:1634543_at:586:95; Interrogation_Position=2187; Antisense; AGATCATGCCTCTACACCTGAAGGT
>probe:Drosophila_2:1634543_at:475:613; Interrogation_Position=2205; Antisense; TGAAGGTCCATGGATCCGTCTGCGC

Paste this into a BLAST search page for me
GAGGTGGCCGCAAATGAATCTTTAAGAGCTAGCTGACCAATCCATTATAGTATTTTTGGAGAGGACACCCTGCTGGTGAGAACGACGTGCAGCCCAGTTGAGTTGCTCAAGCTACGCCAAAAGAAATGAGGCGCACTGAGTTGTCCAATCTTGTCCAATCACTTCGATGGCTGCGAACAACTGCTTCCTTAACCTCAAAGTCAAAGGACTCGTCGGGAGCTTCCAATCACGCCGCGCTAAATCGAAAGCAGGAGATCGACAAGCTCAACCTGAGCAAAGAGACCGTAGGCTGCCCCAGATAGATCATGCCTCTACACCTGAAGGTTGAAGGTCCATGGATCCGTCTGCGC

Full Affymetrix probeset data:

Annotations for 1634543_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720