Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634546_at:

>probe:Drosophila_2:1634546_at:707:663; Interrogation_Position=6352; Antisense; TACACCTTCAACGTGCCAGTTGGCT
>probe:Drosophila_2:1634546_at:680:279; Interrogation_Position=6414; Antisense; CTCAGCCAGTGCAAGCGCAAGCTTA
>probe:Drosophila_2:1634546_at:156:529; Interrogation_Position=6461; Antisense; GGGACGAGCCATTGCAACAGGAAGT
>probe:Drosophila_2:1634546_at:434:189; Interrogation_Position=6476; Antisense; AACAGGAAGTGGATCTCGGCCAGCA
>probe:Drosophila_2:1634546_at:357:99; Interrogation_Position=6537; Antisense; AGAGGACCTTGGACAGCAGACGCAA
>probe:Drosophila_2:1634546_at:607:637; Interrogation_Position=6563; Antisense; TCGAGGACACGGACTGGAACCAGCA
>probe:Drosophila_2:1634546_at:626:379; Interrogation_Position=6579; Antisense; GAACCAGCAGGCAGAGGATCTCGGC
>probe:Drosophila_2:1634546_at:527:77; Interrogation_Position=6620; Antisense; AGGTCGAGGATGACCTCCACTTCGA
>probe:Drosophila_2:1634546_at:366:129; Interrogation_Position=6644; Antisense; ACCAGACGCAGGGTCACAGCAGCAG
>probe:Drosophila_2:1634546_at:724:75; Interrogation_Position=6679; Antisense; AGGAGTCAACCTCTGCAGCAAGCAA
>probe:Drosophila_2:1634546_at:349:585; Interrogation_Position=6716; Antisense; TGGAAGCCACTTCAGAGCCGTCGTT
>probe:Drosophila_2:1634546_at:689:411; Interrogation_Position=6730; Antisense; GAGCCGTCGTTCTGGGAAAAGCTAA
>probe:Drosophila_2:1634546_at:46:371; Interrogation_Position=6759; Antisense; GAAGCTCGGCTAGAGGTCAAACCAA
>probe:Drosophila_2:1634546_at:139:661; Interrogation_Position=6785; Antisense; TAACTGCCATTCATCAACGGACTGT

Paste this into a BLAST search page for me
TACACCTTCAACGTGCCAGTTGGCTCTCAGCCAGTGCAAGCGCAAGCTTAGGGACGAGCCATTGCAACAGGAAGTAACAGGAAGTGGATCTCGGCCAGCAAGAGGACCTTGGACAGCAGACGCAATCGAGGACACGGACTGGAACCAGCAGAACCAGCAGGCAGAGGATCTCGGCAGGTCGAGGATGACCTCCACTTCGAACCAGACGCAGGGTCACAGCAGCAGAGGAGTCAACCTCTGCAGCAAGCAATGGAAGCCACTTCAGAGCCGTCGTTGAGCCGTCGTTCTGGGAAAAGCTAAGAAGCTCGGCTAGAGGTCAAACCAATAACTGCCATTCATCAACGGACTGT

Full Affymetrix probeset data:

Annotations for 1634546_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime