Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634547_at:

>probe:Drosophila_2:1634547_at:62:613; Interrogation_Position=3645; Antisense; TGAAATGGCCGAACGCCACAATGCC
>probe:Drosophila_2:1634547_at:234:69; Interrogation_Position=3649; Antisense; ATGGCCGAACGCCACAATGCCCAAT
>probe:Drosophila_2:1634547_at:106:295; Interrogation_Position=3654; Antisense; CGAACGCCACAATGCCCAATCGGTG
>probe:Drosophila_2:1634547_at:667:161; Interrogation_Position=3662; Antisense; ACAATGCCCAATCGGTGCTCCAATT
>probe:Drosophila_2:1634547_at:94:235; Interrogation_Position=3664; Antisense; AATGCCCAATCGGTGCTCCAATTGG
>probe:Drosophila_2:1634547_at:489:237; Interrogation_Position=3671; Antisense; AATCGGTGCTCCAATTGGCCCGGAG
>probe:Drosophila_2:1634547_at:177:535; Interrogation_Position=3675; Antisense; GGTGCTCCAATTGGCCCGGAGTTTG
>probe:Drosophila_2:1634547_at:196:581; Interrogation_Position=3686; Antisense; TGGCCCGGAGTTTGGTTCTCCAACT
>probe:Drosophila_2:1634547_at:34:289; Interrogation_Position=3691; Antisense; CGGAGTTTGGTTCTCCAACTGCAGA
>probe:Drosophila_2:1634547_at:657:429; Interrogation_Position=3693; Antisense; GAGTTTGGTTCTCCAACTGCAGATG
>probe:Drosophila_2:1634547_at:594:691; Interrogation_Position=3696; Antisense; TTTGGTTCTCCAACTGCAGATGATC
>probe:Drosophila_2:1634547_at:530:541; Interrogation_Position=3699; Antisense; GGTTCTCCAACTGCAGATGATCATC
>probe:Drosophila_2:1634547_at:468:715; Interrogation_Position=3701; Antisense; TTCTCCAACTGCAGATGATCATCGA
>probe:Drosophila_2:1634547_at:665:193; Interrogation_Position=3707; Antisense; AACTGCAGATGATCATCGAGAACAA

Paste this into a BLAST search page for me
TGAAATGGCCGAACGCCACAATGCCATGGCCGAACGCCACAATGCCCAATCGAACGCCACAATGCCCAATCGGTGACAATGCCCAATCGGTGCTCCAATTAATGCCCAATCGGTGCTCCAATTGGAATCGGTGCTCCAATTGGCCCGGAGGGTGCTCCAATTGGCCCGGAGTTTGTGGCCCGGAGTTTGGTTCTCCAACTCGGAGTTTGGTTCTCCAACTGCAGAGAGTTTGGTTCTCCAACTGCAGATGTTTGGTTCTCCAACTGCAGATGATCGGTTCTCCAACTGCAGATGATCATCTTCTCCAACTGCAGATGATCATCGAAACTGCAGATGATCATCGAGAACAA

Full Affymetrix probeset data:

Annotations for 1634547_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime