FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634548_at:

>probe:Drosophila_2:1634548_at:271:689; Interrogation_Position=1010; Antisense; TATTTCCACGCTTCCAGGACATTTA
>probe:Drosophila_2:1634548_at:319:73; Interrogation_Position=1025; Antisense; AGGACATTTACGATCCAGGTGCCCT
>probe:Drosophila_2:1634548_at:569:5; Interrogation_Position=1060; Antisense; ATTGATGACCTGTTCAGCGGTGCAC
>probe:Drosophila_2:1634548_at:502:31; Interrogation_Position=1091; Antisense; ATAATTACCATGTGGCCCAGCAGGC
>probe:Drosophila_2:1634548_at:658:431; Interrogation_Position=1129; Antisense; GAGTCCATTATCGATCCAACTGAAG
>probe:Drosophila_2:1634548_at:619:87; Interrogation_Position=1161; Antisense; AGTCGTTCACGAGTCCAAGTTTAAG
>probe:Drosophila_2:1634548_at:307:253; Interrogation_Position=1200; Antisense; CAAGCACCGTTACACGTTGGTCAAC
>probe:Drosophila_2:1634548_at:663:31; Interrogation_Position=734; Antisense; ATAAGACGTGTGTGCCCCTGGTGCG
>probe:Drosophila_2:1634548_at:178:409; Interrogation_Position=832; Antisense; GACGATCTAAGTCCCATCCAGGAGT
>probe:Drosophila_2:1634548_at:240:433; Interrogation_Position=894; Antisense; GAGGGTTATTTTCCTGACTGCCGAA
>probe:Drosophila_2:1634548_at:262:659; Interrogation_Position=930; Antisense; TAAGCACCCACTTTTCCATTTGGGA
>probe:Drosophila_2:1634548_at:717:213; Interrogation_Position=955; Antisense; AAGTCCCCGAGTGATTTGCCAGTGA
>probe:Drosophila_2:1634548_at:336:513; Interrogation_Position=976; Antisense; GTGATCGCAATCGATTCCTTCATGC
>probe:Drosophila_2:1634548_at:58:713; Interrogation_Position=994; Antisense; TTCATGCACATGTACCTATTTCCAC

Paste this into a BLAST search page for me
TATTTCCACGCTTCCAGGACATTTAAGGACATTTACGATCCAGGTGCCCTATTGATGACCTGTTCAGCGGTGCACATAATTACCATGTGGCCCAGCAGGCGAGTCCATTATCGATCCAACTGAAGAGTCGTTCACGAGTCCAAGTTTAAGCAAGCACCGTTACACGTTGGTCAACATAAGACGTGTGTGCCCCTGGTGCGGACGATCTAAGTCCCATCCAGGAGTGAGGGTTATTTTCCTGACTGCCGAATAAGCACCCACTTTTCCATTTGGGAAAGTCCCCGAGTGATTTGCCAGTGAGTGATCGCAATCGATTCCTTCATGCTTCATGCACATGTACCTATTTCCAC

Full Affymetrix probeset data:

Annotations for 1634548_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720