Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634549_at:

>probe:Drosophila_2:1634549_at:424:673; Interrogation_Position=1053; Antisense; TAGCACGTGGGAAATTTACGTTCTA
>probe:Drosophila_2:1634549_at:582:675; Interrogation_Position=1122; Antisense; TAGTATTGTCCGAAACCGACGTTTG
>probe:Drosophila_2:1634549_at:139:391; Interrogation_Position=1133; Antisense; GAAACCGACGTTTGAAGACTAGAAT
>probe:Drosophila_2:1634549_at:131:679; Interrogation_Position=1220; Antisense; TAGGCAACTGTAGATCAGTCAACTT
>probe:Drosophila_2:1634549_at:69:385; Interrogation_Position=1257; Antisense; GAACTGAATTTCACTAATAGCTGTT
>probe:Drosophila_2:1634549_at:75:225; Interrogation_Position=1355; Antisense; AAGGCAACTGTAGATCAGTCAACTT
>probe:Drosophila_2:1634549_at:630:35; Interrogation_Position=1368; Antisense; ATCAGTCAACTTCCGTACATACAAC
>probe:Drosophila_2:1634549_at:353:231; Interrogation_Position=1401; Antisense; AATGAATCAGCACAGTTGCCCTACT
>probe:Drosophila_2:1634549_at:643:355; Interrogation_Position=1410; Antisense; GCACAGTTGCCCTACTAAACAATAT
>probe:Drosophila_2:1634549_at:611:185; Interrogation_Position=1427; Antisense; AACAATATCAACTTCTCATGAGCTA
>probe:Drosophila_2:1634549_at:608:603; Interrogation_Position=1473; Antisense; TGATAAGCCAAGGTTGTTCCGGAAA
>probe:Drosophila_2:1634549_at:493:515; Interrogation_Position=1568; Antisense; GTGTAGATTAGAATTCCCATATGCT
>probe:Drosophila_2:1634549_at:615:245; Interrogation_Position=1579; Antisense; AATTCCCATATGCTGCTAACCTAAT
>probe:Drosophila_2:1634549_at:293:339; Interrogation_Position=1593; Antisense; GCTAACCTAATGGTTCGCAGTTAAT

Paste this into a BLAST search page for me
TAGCACGTGGGAAATTTACGTTCTATAGTATTGTCCGAAACCGACGTTTGGAAACCGACGTTTGAAGACTAGAATTAGGCAACTGTAGATCAGTCAACTTGAACTGAATTTCACTAATAGCTGTTAAGGCAACTGTAGATCAGTCAACTTATCAGTCAACTTCCGTACATACAACAATGAATCAGCACAGTTGCCCTACTGCACAGTTGCCCTACTAAACAATATAACAATATCAACTTCTCATGAGCTATGATAAGCCAAGGTTGTTCCGGAAAGTGTAGATTAGAATTCCCATATGCTAATTCCCATATGCTGCTAACCTAATGCTAACCTAATGGTTCGCAGTTAAT

Full Affymetrix probeset data:

Annotations for 1634549_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime