FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634550_at:

>probe:Drosophila_2:1634550_at:125:245; Interrogation_Position=1623; Antisense; AATTTGCGCTTTTCATTTGTGCTTT
>probe:Drosophila_2:1634550_at:457:143; Interrogation_Position=1664; Antisense; ACTCAAACGTGGAGCGCTGGTCAGT
>probe:Drosophila_2:1634550_at:142:591; Interrogation_Position=1681; Antisense; TGGTCAGTGACGCTACTCCGACTAT
>probe:Drosophila_2:1634550_at:455:327; Interrogation_Position=1716; Antisense; GCGTCATATGGATCGGGCAGTGCTC
>probe:Drosophila_2:1634550_at:115:459; Interrogation_Position=1789; Antisense; GATTTACGATATTAACCCTCACCGC
>probe:Drosophila_2:1634550_at:165:259; Interrogation_Position=1808; Antisense; CACCGCATTCTTAAACGTTCTGCTG
>probe:Drosophila_2:1634550_at:651:389; Interrogation_Position=1832; Antisense; GAAACACGACACCTGCTGTTTTCAA
>probe:Drosophila_2:1634550_at:404:57; Interrogation_Position=1851; Antisense; TTTCAATCCCACTCCCAAGTAGTTA
>probe:Drosophila_2:1634550_at:535:677; Interrogation_Position=1924; Antisense; TAGTATGTTACAGTGTGCGCCCAAC
>probe:Drosophila_2:1634550_at:680:505; Interrogation_Position=1938; Antisense; GTGCGCCCAACTTCCGTAGGAAAGA
>probe:Drosophila_2:1634550_at:59:95; Interrogation_Position=1991; Antisense; AGTTCCAGTGCGAGTTTCCGATTAG
>probe:Drosophila_2:1634550_at:509:461; Interrogation_Position=2010; Antisense; GATTAGAGCCCGACCAGGATTATCT
>probe:Drosophila_2:1634550_at:626:77; Interrogation_Position=2025; Antisense; AGGATTATCTCGCTTTTGGCAACAG
>probe:Drosophila_2:1634550_at:283:297; Interrogation_Position=2060; Antisense; CGCAGGCCTGCGATCGTGCAAATAG

Paste this into a BLAST search page for me
AATTTGCGCTTTTCATTTGTGCTTTACTCAAACGTGGAGCGCTGGTCAGTTGGTCAGTGACGCTACTCCGACTATGCGTCATATGGATCGGGCAGTGCTCGATTTACGATATTAACCCTCACCGCCACCGCATTCTTAAACGTTCTGCTGGAAACACGACACCTGCTGTTTTCAATTTCAATCCCACTCCCAAGTAGTTATAGTATGTTACAGTGTGCGCCCAACGTGCGCCCAACTTCCGTAGGAAAGAAGTTCCAGTGCGAGTTTCCGATTAGGATTAGAGCCCGACCAGGATTATCTAGGATTATCTCGCTTTTGGCAACAGCGCAGGCCTGCGATCGTGCAAATAG

Full Affymetrix probeset data:

Annotations for 1634550_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720