FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634551_at:

>probe:Drosophila_2:1634551_at:517:127; Interrogation_Position=406; Antisense; AGCCAACTGGTTGACACTGTACGAC
>probe:Drosophila_2:1634551_at:197:489; Interrogation_Position=424; Antisense; GTACGACGACATTCAGGAGCACATT
>probe:Drosophila_2:1634551_at:575:713; Interrogation_Position=447; Antisense; TTCAGGATGGTTTCGATGCCGTCAT
>probe:Drosophila_2:1634551_at:695:447; Interrogation_Position=461; Antisense; GATGCCGTCATTTGCTTGGGCAACT
>probe:Drosophila_2:1634551_at:718:693; Interrogation_Position=488; Antisense; TTTGCCCACTTGATGGACGGGTTCG
>probe:Drosophila_2:1634551_at:339:207; Interrogation_Position=530; Antisense; AAGCAGGCTATTGGCAACTTCGAAA
>probe:Drosophila_2:1634551_at:698:585; Interrogation_Position=568; Antisense; TGGAGGCGTCCTGCTTATCGATCAT
>probe:Drosophila_2:1634551_at:635:177; Interrogation_Position=615; Antisense; AAACGGGAGCTACGCCTGCCAAGAG
>probe:Drosophila_2:1634551_at:123:27; Interrogation_Position=651; Antisense; ATACGAGTCACACGGCGGACATCAA
>probe:Drosophila_2:1634551_at:184:47; Interrogation_Position=679; Antisense; ATCCGTGCTCTTCTACTGCGGTAAG
>probe:Drosophila_2:1634551_at:716:491; Interrogation_Position=699; Antisense; GTAAGCCCGCCCTGGTGTCGATGGA
>probe:Drosophila_2:1634551_at:109:587; Interrogation_Position=720; Antisense; TGGACTACCTGATCGCTGGCAACAA
>probe:Drosophila_2:1634551_at:57:95; Interrogation_Position=744; Antisense; AGTTGACCAGTGAGTTCCGTCTGTC
>probe:Drosophila_2:1634551_at:496:427; Interrogation_Position=800; Antisense; GAGATTCTAGCCGAGATCTTCTCCG

Paste this into a BLAST search page for me
AGCCAACTGGTTGACACTGTACGACGTACGACGACATTCAGGAGCACATTTTCAGGATGGTTTCGATGCCGTCATGATGCCGTCATTTGCTTGGGCAACTTTTGCCCACTTGATGGACGGGTTCGAAGCAGGCTATTGGCAACTTCGAAATGGAGGCGTCCTGCTTATCGATCATAAACGGGAGCTACGCCTGCCAAGAGATACGAGTCACACGGCGGACATCAAATCCGTGCTCTTCTACTGCGGTAAGGTAAGCCCGCCCTGGTGTCGATGGATGGACTACCTGATCGCTGGCAACAAAGTTGACCAGTGAGTTCCGTCTGTCGAGATTCTAGCCGAGATCTTCTCCG

Full Affymetrix probeset data:

Annotations for 1634551_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720