Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634552_at:

>probe:Drosophila_2:1634552_at:197:155; Interrogation_Position=4025; Antisense; ACAGGGCACCAAGTCGCTGGAGTTT
>probe:Drosophila_2:1634552_at:303:709; Interrogation_Position=4129; Antisense; TTAAGATTCAGACCACCGTTTTGCC
>probe:Drosophila_2:1634552_at:442:563; Interrogation_Position=4154; Antisense; GGAATCGTCGCCAGCCAATTTGGAA
>probe:Drosophila_2:1634552_at:105:193; Interrogation_Position=4177; Antisense; AACTAAGCGTCTGCGTGGACTACGT
>probe:Drosophila_2:1634552_at:79:627; Interrogation_Position=4252; Antisense; TGCCGTCTGGTTATACTGCTGATGA
>probe:Drosophila_2:1634552_at:239:285; Interrogation_Position=4270; Antisense; CTGATGAGGATAGCTTCGCCGACAT
>probe:Drosophila_2:1634552_at:598:631; Interrogation_Position=4294; Antisense; TCCGGAACATCGAACGTGTGCGGTT
>probe:Drosophila_2:1634552_at:353:145; Interrogation_Position=4339; Antisense; ACTCCGTGGTGGTCATATACTTCGA
>probe:Drosophila_2:1634552_at:299:107; Interrogation_Position=4410; Antisense; AGAACACATGCGGTGGCCAACCAGA
>probe:Drosophila_2:1634552_at:263:291; Interrogation_Position=4444; Antisense; CGGTGGTCCTCTACGATTACTATGA
>probe:Drosophila_2:1634552_at:391:109; Interrogation_Position=4477; Antisense; AGAAGGCCACCGAATACTACTCCAT
>probe:Drosophila_2:1634552_at:620:667; Interrogation_Position=4494; Antisense; TACTCCATCAAGTCGAAGCTCTGCG
>probe:Drosophila_2:1634552_at:26:623; Interrogation_Position=4515; Antisense; TGCGACATTTGCGAGGGTGACGACT
>probe:Drosophila_2:1634552_at:256:421; Interrogation_Position=4544; Antisense; GAGCAAGTGCTAGAGTATCCAAACC

Paste this into a BLAST search page for me
ACAGGGCACCAAGTCGCTGGAGTTTTTAAGATTCAGACCACCGTTTTGCCGGAATCGTCGCCAGCCAATTTGGAAAACTAAGCGTCTGCGTGGACTACGTTGCCGTCTGGTTATACTGCTGATGACTGATGAGGATAGCTTCGCCGACATTCCGGAACATCGAACGTGTGCGGTTACTCCGTGGTGGTCATATACTTCGAAGAACACATGCGGTGGCCAACCAGACGGTGGTCCTCTACGATTACTATGAAGAAGGCCACCGAATACTACTCCATTACTCCATCAAGTCGAAGCTCTGCGTGCGACATTTGCGAGGGTGACGACTGAGCAAGTGCTAGAGTATCCAAACC

Full Affymetrix probeset data:

Annotations for 1634552_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime