Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634554_at:

>probe:Drosophila_2:1634554_at:563:555; Interrogation_Position=180; Antisense; GGACGATGGCTTCTCCATCTGGGAA
>probe:Drosophila_2:1634554_at:307:563; Interrogation_Position=201; Antisense; GGAATCCCGTGCCATTTTGATTTAC
>probe:Drosophila_2:1634554_at:582:89; Interrogation_Position=236; Antisense; AGTACGGCGCTGATGACTCGCTGTA
>probe:Drosophila_2:1634554_at:193:685; Interrogation_Position=259; Antisense; TATCCCAGCGATCCCCAGAAGAAGG
>probe:Drosophila_2:1634554_at:654:573; Interrogation_Position=282; Antisense; GGCTGTGGTCAATCAGAGGCTCTAC
>probe:Drosophila_2:1634554_at:286:715; Interrogation_Position=307; Antisense; TTCGACATGGGCACCCTGTTTCAGA
>probe:Drosophila_2:1634554_at:467:285; Interrogation_Position=322; Antisense; CTGTTTCAGAGTTTCGTCGAGGCCA
>probe:Drosophila_2:1634554_at:601:501; Interrogation_Position=337; Antisense; GTCGAGGCCATCTATCCACAGATAA
>probe:Drosophila_2:1634554_at:455:657; Interrogation_Position=359; Antisense; TAAGGAATAATCATCCCGCCGATCC
>probe:Drosophila_2:1634554_at:382:267; Interrogation_Position=390; Antisense; CATGCAGAAAGTGGACAGCGCCTTT
>probe:Drosophila_2:1634554_at:295:533; Interrogation_Position=516; Antisense; GGTGGACTTCGATATAGCCCAGTAT
>probe:Drosophila_2:1634554_at:220:293; Interrogation_Position=54; Antisense; CGTTATAATGACAGCCAAGGCCCTT
>probe:Drosophila_2:1634554_at:558:519; Interrogation_Position=602; Antisense; GGGACGGTGTACAGCTAATCAAGAA
>probe:Drosophila_2:1634554_at:382:249; Interrogation_Position=69; Antisense; CAAGGCCCTTGGAGTTGACCTGAAT

Paste this into a BLAST search page for me
GGACGATGGCTTCTCCATCTGGGAAGGAATCCCGTGCCATTTTGATTTACAGTACGGCGCTGATGACTCGCTGTATATCCCAGCGATCCCCAGAAGAAGGGGCTGTGGTCAATCAGAGGCTCTACTTCGACATGGGCACCCTGTTTCAGACTGTTTCAGAGTTTCGTCGAGGCCAGTCGAGGCCATCTATCCACAGATAATAAGGAATAATCATCCCGCCGATCCCATGCAGAAAGTGGACAGCGCCTTTGGTGGACTTCGATATAGCCCAGTATCGTTATAATGACAGCCAAGGCCCTTGGGACGGTGTACAGCTAATCAAGAACAAGGCCCTTGGAGTTGACCTGAAT

Full Affymetrix probeset data:

Annotations for 1634554_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime