Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634555_at:

>probe:Drosophila_2:1634555_at:641:455; Interrogation_Position=4777; Antisense; GATACAAACTTTACCGATACCCATT
>probe:Drosophila_2:1634555_at:497:669; Interrogation_Position=4794; Antisense; TACCCATTTTATACAAGTCGCCCCA
>probe:Drosophila_2:1634555_at:165:211; Interrogation_Position=4851; Antisense; AAGAATAGCATTCCCGCGAAGGTAA
>probe:Drosophila_2:1634555_at:559:509; Interrogation_Position=4942; Antisense; GTGCACCCATCCAGCTTAAGTAGAT
>probe:Drosophila_2:1634555_at:437:657; Interrogation_Position=4958; Antisense; TAAGTAGATGCAGCTCGCACACCAA
>probe:Drosophila_2:1634555_at:105:33; Interrogation_Position=4989; Antisense; ATCACAAGCAGTGCGTTTCGGGACT
>probe:Drosophila_2:1634555_at:50:459; Interrogation_Position=5046; Antisense; GATTTTATTTGATTGTCGAACCCGT
>probe:Drosophila_2:1634555_at:495:189; Interrogation_Position=5084; Antisense; AACATTTGGCCTTACTCGATGGAAA
>probe:Drosophila_2:1634555_at:529:245; Interrogation_Position=5107; Antisense; AATTAAACTCGCGTTGCGCCAGCGG
>probe:Drosophila_2:1634555_at:345:313; Interrogation_Position=5124; Antisense; GCCAGCGGTCTTACAGTTCTGAATC
>probe:Drosophila_2:1634555_at:422:615; Interrogation_Position=5143; Antisense; TGAATCCCACTGTACCAGCGCTATT
>probe:Drosophila_2:1634555_at:421:323; Interrogation_Position=5160; Antisense; GCGCTATTGCCGCACATAGTCGATA
>probe:Drosophila_2:1634555_at:591:87; Interrogation_Position=5177; Antisense; AGTCGATAAGTCAACCTGCCAAGCT
>probe:Drosophila_2:1634555_at:116:677; Interrogation_Position=5220; Antisense; TAGTTCCCAACTCCAGTAGCAGTTA

Paste this into a BLAST search page for me
GATACAAACTTTACCGATACCCATTTACCCATTTTATACAAGTCGCCCCAAAGAATAGCATTCCCGCGAAGGTAAGTGCACCCATCCAGCTTAAGTAGATTAAGTAGATGCAGCTCGCACACCAAATCACAAGCAGTGCGTTTCGGGACTGATTTTATTTGATTGTCGAACCCGTAACATTTGGCCTTACTCGATGGAAAAATTAAACTCGCGTTGCGCCAGCGGGCCAGCGGTCTTACAGTTCTGAATCTGAATCCCACTGTACCAGCGCTATTGCGCTATTGCCGCACATAGTCGATAAGTCGATAAGTCAACCTGCCAAGCTTAGTTCCCAACTCCAGTAGCAGTTA

Full Affymetrix probeset data:

Annotations for 1634555_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime