FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634557_at:

>probe:Drosophila_2:1634557_at:673:605; Interrogation_Position=1752; Antisense; TGAGAACTTTGGCTTCCATGTGCGC
>probe:Drosophila_2:1634557_at:290:513; Interrogation_Position=1789; Antisense; GTGATCATTGCCCACGTTGAGATTA
>probe:Drosophila_2:1634557_at:181:245; Interrogation_Position=1813; Antisense; AATTCTTTGGCAGACCTTGGCGGCA
>probe:Drosophila_2:1634557_at:319:221; Interrogation_Position=1882; Antisense; AAGTGGTACTCCCATCAGCAGGTGG
>probe:Drosophila_2:1634557_at:319:349; Interrogation_Position=1899; Antisense; GCAGGTGGTGCAGCTCATACAATCC
>probe:Drosophila_2:1634557_at:476:603; Interrogation_Position=1949; Antisense; TGATAACGCCCATGGATCGCAACTA
>probe:Drosophila_2:1634557_at:148:147; Interrogation_Position=1970; Antisense; ACTACTTGAAGCCATTGTCGTCGAA
>probe:Drosophila_2:1634557_at:695:81; Interrogation_Position=1994; Antisense; AGGGCTCATTATCAACGCTATCGGC
>probe:Drosophila_2:1634557_at:467:93; Interrogation_Position=2023; Antisense; AGTTCATCGGGCATTTCATCCGGAT
>probe:Drosophila_2:1634557_at:398:87; Interrogation_Position=2053; Antisense; AGTCCCACAAGTATTGCGGCCAAGC
>probe:Drosophila_2:1634557_at:82:611; Interrogation_Position=2090; Antisense; TGAAAACATCCTCTAGTTCGCGACC
>probe:Drosophila_2:1634557_at:388:353; Interrogation_Position=2120; Antisense; GCAGCGTTTCATCCAGTTCGTGGAA
>probe:Drosophila_2:1634557_at:362:265; Interrogation_Position=2133; Antisense; CAGTTCGTGGAATCCGTTTCGGCGA
>probe:Drosophila_2:1634557_at:509:639; Interrogation_Position=2151; Antisense; TCGGCGAACGCCTAGCTTAGCTAAA

Paste this into a BLAST search page for me
TGAGAACTTTGGCTTCCATGTGCGCGTGATCATTGCCCACGTTGAGATTAAATTCTTTGGCAGACCTTGGCGGCAAAGTGGTACTCCCATCAGCAGGTGGGCAGGTGGTGCAGCTCATACAATCCTGATAACGCCCATGGATCGCAACTAACTACTTGAAGCCATTGTCGTCGAAAGGGCTCATTATCAACGCTATCGGCAGTTCATCGGGCATTTCATCCGGATAGTCCCACAAGTATTGCGGCCAAGCTGAAAACATCCTCTAGTTCGCGACCGCAGCGTTTCATCCAGTTCGTGGAACAGTTCGTGGAATCCGTTTCGGCGATCGGCGAACGCCTAGCTTAGCTAAA

Full Affymetrix probeset data:

Annotations for 1634557_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720