FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634559_at:

>probe:Drosophila_2:1634559_at:458:547; Interrogation_Position=1029; Antisense; GGATGCGGTGCTGCGAAATTCGATC
>probe:Drosophila_2:1634559_at:374:729; Interrogation_Position=1064; Antisense; TTGTGAACGCCTACTTCAGCTACAT
>probe:Drosophila_2:1634559_at:565:683; Interrogation_Position=1117; Antisense; TATCAGTCCCTAGTCGAAGTGCAGA
>probe:Drosophila_2:1634559_at:713:395; Interrogation_Position=1187; Antisense; GACAACAACAGGACTCGGGCGTCGA
>probe:Drosophila_2:1634559_at:410:293; Interrogation_Position=1209; Antisense; CGAGGACACAGGACACCAGCGGACA
>probe:Drosophila_2:1634559_at:607:399; Interrogation_Position=1230; Antisense; GACAGGACACCAGCGGAGGGCCAAA
>probe:Drosophila_2:1634559_at:428:185; Interrogation_Position=1253; Antisense; AACAATTTCGTGCTCGTTGGCAAAG
>probe:Drosophila_2:1634559_at:316:261; Interrogation_Position=1311; Antisense; CAGCTCTGTCCCAAAGAAGTCGAAT
>probe:Drosophila_2:1634559_at:513:553; Interrogation_Position=1338; Antisense; GGACCAACAGGACGGCACAGTGTAA
>probe:Drosophila_2:1634559_at:435:153; Interrogation_Position=1404; Antisense; ACAGGCTACGTAGTTCTCATTGCAG
>probe:Drosophila_2:1634559_at:304:523; Interrogation_Position=928; Antisense; GTGGCCAGGAACACCATCGGCGAAG
>probe:Drosophila_2:1634559_at:451:375; Interrogation_Position=949; Antisense; GAAGAGACCACCAAGAGCAGACGCT
>probe:Drosophila_2:1634559_at:405:351; Interrogation_Position=965; Antisense; GCAGACGCTTGATGGCCATACGGAA
>probe:Drosophila_2:1634559_at:313:29; Interrogation_Position=982; Antisense; ATACGGAAACAGTTGCTGCGCGCCC

Paste this into a BLAST search page for me
GGATGCGGTGCTGCGAAATTCGATCTTGTGAACGCCTACTTCAGCTACATTATCAGTCCCTAGTCGAAGTGCAGAGACAACAACAGGACTCGGGCGTCGACGAGGACACAGGACACCAGCGGACAGACAGGACACCAGCGGAGGGCCAAAAACAATTTCGTGCTCGTTGGCAAAGCAGCTCTGTCCCAAAGAAGTCGAATGGACCAACAGGACGGCACAGTGTAAACAGGCTACGTAGTTCTCATTGCAGGTGGCCAGGAACACCATCGGCGAAGGAAGAGACCACCAAGAGCAGACGCTGCAGACGCTTGATGGCCATACGGAAATACGGAAACAGTTGCTGCGCGCCC

Full Affymetrix probeset data:

Annotations for 1634559_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720