FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634560_at:

>probe:Drosophila_2:1634560_at:537:299; Interrogation_Position=293; Antisense; CGCGCGTGGCCTACATGAATTTCAT
>probe:Drosophila_2:1634560_at:713:579; Interrogation_Position=330; Antisense; GGCCACAGCATTTAAATCGCACTTT
>probe:Drosophila_2:1634560_at:629:253; Interrogation_Position=390; Antisense; CAACTTTGCCAAAGGCGGCTTCAAA
>probe:Drosophila_2:1634560_at:588:589; Interrogation_Position=428; Antisense; TGGGACTTTTTACCACATCCTACTT
>probe:Drosophila_2:1634560_at:182:279; Interrogation_Position=447; Antisense; CTACTTCGGCATCATCACTTGTATG
>probe:Drosophila_2:1634560_at:716:371; Interrogation_Position=471; Antisense; GTCGGTGTACCGTGGAAAATCCTCA
>probe:Drosophila_2:1634560_at:559:231; Interrogation_Position=503; Antisense; AATACTTGGCCGCTGGTTCCATCAC
>probe:Drosophila_2:1634560_at:257:33; Interrogation_Position=523; Antisense; ATCACCGGCTCGCTTTACAAAGTGA
>probe:Drosophila_2:1634560_at:222:239; Interrogation_Position=579; Antisense; AATCATTGGAGGTTTCTTGGGCGGC
>probe:Drosophila_2:1634560_at:540:375; Interrogation_Position=655; Antisense; GAAGAGGTTCGCTACTGGCAGTACA
>probe:Drosophila_2:1634560_at:464:169; Interrogation_Position=679; Antisense; AAATGGCGACTCGATCGCGACGAAA
>probe:Drosophila_2:1634560_at:451:151; Interrogation_Position=730; Antisense; ACAGAGGACGAAAACCCAGAGCTTT
>probe:Drosophila_2:1634560_at:329:151; Interrogation_Position=775; Antisense; ACATCCGAACATGTATCGCTGGACA
>probe:Drosophila_2:1634560_at:3:411; Interrogation_Position=830; Antisense; GACGCCAGTGTGAACTTAGTTACTT

Paste this into a BLAST search page for me
CGCGCGTGGCCTACATGAATTTCATGGCCACAGCATTTAAATCGCACTTTCAACTTTGCCAAAGGCGGCTTCAAATGGGACTTTTTACCACATCCTACTTCTACTTCGGCATCATCACTTGTATGGTCGGTGTACCGTGGAAAATCCTCAAATACTTGGCCGCTGGTTCCATCACATCACCGGCTCGCTTTACAAAGTGAAATCATTGGAGGTTTCTTGGGCGGCGAAGAGGTTCGCTACTGGCAGTACAAAATGGCGACTCGATCGCGACGAAAACAGAGGACGAAAACCCAGAGCTTTACATCCGAACATGTATCGCTGGACAGACGCCAGTGTGAACTTAGTTACTT

Full Affymetrix probeset data:

Annotations for 1634560_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720