FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634563_at:

>probe:Drosophila_2:1634563_at:182:565; Interrogation_Position=4584; Antisense; GGAATCTAGCGCCTAAATGCAGGAT
>probe:Drosophila_2:1634563_at:73:705; Interrogation_Position=4613; Antisense; TTATGAGCCGTAGCTTAGCCGTAGC
>probe:Drosophila_2:1634563_at:534:485; Interrogation_Position=4633; Antisense; GTAGCCCTCGAACGAAACCAATCCA
>probe:Drosophila_2:1634563_at:212:385; Interrogation_Position=4662; Antisense; GAACTTCAACGATTGGTTTCTGACT
>probe:Drosophila_2:1634563_at:565:539; Interrogation_Position=4676; Antisense; GGTTTCTGACTATTGTAATCGCCCA
>probe:Drosophila_2:1634563_at:442:513; Interrogation_Position=4701; Antisense; GTGTAAATGGGTCCTTCATCGAAAT
>probe:Drosophila_2:1634563_at:187:43; Interrogation_Position=4718; Antisense; ATCGAAATTTACCACATCCACTCAT
>probe:Drosophila_2:1634563_at:164:311; Interrogation_Position=4735; Antisense; CCACTCATCGCGGTCACATGAAGAA
>probe:Drosophila_2:1634563_at:50:271; Interrogation_Position=4771; Antisense; CATCTGGGTTAGAATTAGCCGGGCC
>probe:Drosophila_2:1634563_at:628:459; Interrogation_Position=4823; Antisense; GATTATGACGACTCCGGCTTAGCAG
>probe:Drosophila_2:1634563_at:348:571; Interrogation_Position=4838; Antisense; GGCTTAGCAGCACTCGAAACGGGCT
>probe:Drosophila_2:1634563_at:514:391; Interrogation_Position=4853; Antisense; GAAACGGGCTGCTATCGGATCGATC
>probe:Drosophila_2:1634563_at:46:451; Interrogation_Position=4878; Antisense; GATCGCCAGAACATATCTTGCTCCG
>probe:Drosophila_2:1634563_at:89:29; Interrogation_Position=4989; Antisense; ATACGCTAGGGATGCAGCTACTAAA

Paste this into a BLAST search page for me
GGAATCTAGCGCCTAAATGCAGGATTTATGAGCCGTAGCTTAGCCGTAGCGTAGCCCTCGAACGAAACCAATCCAGAACTTCAACGATTGGTTTCTGACTGGTTTCTGACTATTGTAATCGCCCAGTGTAAATGGGTCCTTCATCGAAATATCGAAATTTACCACATCCACTCATCCACTCATCGCGGTCACATGAAGAACATCTGGGTTAGAATTAGCCGGGCCGATTATGACGACTCCGGCTTAGCAGGGCTTAGCAGCACTCGAAACGGGCTGAAACGGGCTGCTATCGGATCGATCGATCGCCAGAACATATCTTGCTCCGATACGCTAGGGATGCAGCTACTAAA

Full Affymetrix probeset data:

Annotations for 1634563_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720