FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634565_at:

>probe:Drosophila_2:1634565_at:720:177; Interrogation_Position=258; Antisense; AAACATGCCCAGTGGCACCATACAA
>probe:Drosophila_2:1634565_at:553:109; Interrogation_Position=323; Antisense; AGAAGTACCGACTCGACATCAAGTA
>probe:Drosophila_2:1634565_at:492:391; Interrogation_Position=353; Antisense; GAAACGTGTACCTCATATGCATTTT
>probe:Drosophila_2:1634565_at:210:681; Interrogation_Position=379; Antisense; TATACCGACAACTTTTCTGGCGTTA
>probe:Drosophila_2:1634565_at:215:641; Interrogation_Position=394; Antisense; TCTGGCGTTAAAATGGATGCGACAC
>probe:Drosophila_2:1634565_at:96:127; Interrogation_Position=432; Antisense; AGCCGGAGGCGAATTCATGGATGTT
>probe:Drosophila_2:1634565_at:162:269; Interrogation_Position=447; Antisense; CATGGATGTTGGAAGCCTATTCGAG
>probe:Drosophila_2:1634565_at:626:725; Interrogation_Position=481; Antisense; TTGATTGAAACTCGCTATGATACTG
>probe:Drosophila_2:1634565_at:162:605; Interrogation_Position=549; Antisense; TGATGCTATAGAGTTGGGCGCCGAA
>probe:Drosophila_2:1634565_at:709:395; Interrogation_Position=589; Antisense; GACAATGTCGATGGCTCCGTCAATT
>probe:Drosophila_2:1634565_at:282:291; Interrogation_Position=606; Antisense; CGTCAATTTCCTATGCAGTCCAGTG
>probe:Drosophila_2:1634565_at:60:351; Interrogation_Position=620; Antisense; GCAGTCCAGTGGTTTTAACTAGCTT
>probe:Drosophila_2:1634565_at:15:705; Interrogation_Position=721; Antisense; TTATCACCCGAAGAGCAAAAGACCT
>probe:Drosophila_2:1634565_at:360:189; Interrogation_Position=764; Antisense; AACTGAGAAACCTCCCAGGCTTAGA

Paste this into a BLAST search page for me
AAACATGCCCAGTGGCACCATACAAAGAAGTACCGACTCGACATCAAGTAGAAACGTGTACCTCATATGCATTTTTATACCGACAACTTTTCTGGCGTTATCTGGCGTTAAAATGGATGCGACACAGCCGGAGGCGAATTCATGGATGTTCATGGATGTTGGAAGCCTATTCGAGTTGATTGAAACTCGCTATGATACTGTGATGCTATAGAGTTGGGCGCCGAAGACAATGTCGATGGCTCCGTCAATTCGTCAATTTCCTATGCAGTCCAGTGGCAGTCCAGTGGTTTTAACTAGCTTTTATCACCCGAAGAGCAAAAGACCTAACTGAGAAACCTCCCAGGCTTAGA

Full Affymetrix probeset data:

Annotations for 1634565_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720