Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634567_at:

>probe:Drosophila_2:1634567_at:640:205; Interrogation_Position=1514; Antisense; AAGCGTCCTCTGTCAAATCGGCGAT
>probe:Drosophila_2:1634567_at:604:595; Interrogation_Position=1554; Antisense; TGTGGTCAACGTTACGGCGGCCAAA
>probe:Drosophila_2:1634567_at:48:575; Interrogation_Position=1569; Antisense; GGCGGCCAAACATTTGCGTGGTATC
>probe:Drosophila_2:1634567_at:482:517; Interrogation_Position=1586; Antisense; GTGGTATCCACGCATCGACGGCAGT
>probe:Drosophila_2:1634567_at:498:451; Interrogation_Position=1693; Antisense; GATCTCCAGGCGGTTGGGTCCAATC
>probe:Drosophila_2:1634567_at:211:113; Interrogation_Position=1729; Antisense; AGCACTGCTCACGTGGAAACCGAAG
>probe:Drosophila_2:1634567_at:61:599; Interrogation_Position=1760; Antisense; TGTCCAAGCGGCGTTTTATACCCAG
>probe:Drosophila_2:1634567_at:221:673; Interrogation_Position=1778; Antisense; TACCCAGCACTGAAATCGAGCATGT
>probe:Drosophila_2:1634567_at:11:623; Interrogation_Position=1802; Antisense; TGCTGCACACATCTTTGGACCAAAT
>probe:Drosophila_2:1634567_at:355:165; Interrogation_Position=1823; Antisense; AAATCGGGCGTAATCTTACCCAGCA
>probe:Drosophila_2:1634567_at:132:707; Interrogation_Position=1838; Antisense; TTACCCAGCAGCTCAATGTGGCCAG
>probe:Drosophila_2:1634567_at:549:431; Interrogation_Position=1878; Antisense; GAGTCAGCGATACGAGTTGCCCCAT
>probe:Drosophila_2:1634567_at:710:351; Interrogation_Position=1992; Antisense; GCAGCATAAGGCAAGCACCCGGAAG
>probe:Drosophila_2:1634567_at:504:259; Interrogation_Position=2007; Antisense; CACCCGGAAGTCATCGGATTCGGAT

Paste this into a BLAST search page for me
AAGCGTCCTCTGTCAAATCGGCGATTGTGGTCAACGTTACGGCGGCCAAAGGCGGCCAAACATTTGCGTGGTATCGTGGTATCCACGCATCGACGGCAGTGATCTCCAGGCGGTTGGGTCCAATCAGCACTGCTCACGTGGAAACCGAAGTGTCCAAGCGGCGTTTTATACCCAGTACCCAGCACTGAAATCGAGCATGTTGCTGCACACATCTTTGGACCAAATAAATCGGGCGTAATCTTACCCAGCATTACCCAGCAGCTCAATGTGGCCAGGAGTCAGCGATACGAGTTGCCCCATGCAGCATAAGGCAAGCACCCGGAAGCACCCGGAAGTCATCGGATTCGGAT

Full Affymetrix probeset data:

Annotations for 1634567_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime