FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634569_at:

>probe:Drosophila_2:1634569_at:118:561; Interrogation_Position=114; Antisense; GGAAAGACAGCGTCATCTCCGAGCA
>probe:Drosophila_2:1634569_at:438:615; Interrogation_Position=146; Antisense; TGCACAGGCCTCCATACGATGGATA
>probe:Drosophila_2:1634569_at:587:35; Interrogation_Position=172; Antisense; GATTGGCACAAACACTTTAACCGAG
>probe:Drosophila_2:1634569_at:356:697; Interrogation_Position=187; Antisense; TTTAACCGAGATGCCGAACCAAAGG
>probe:Drosophila_2:1634569_at:374:685; Interrogation_Position=294; Antisense; TATTTCGAACTGGAGCAGAGCTCGG
>probe:Drosophila_2:1634569_at:66:119; Interrogation_Position=312; Antisense; AGCTCGGAGCGCCTACCAAAAAGAG
>probe:Drosophila_2:1634569_at:490:13; Interrogation_Position=448; Antisense; ATTCAAACGGTTGTCCAGATCCTGA
>probe:Drosophila_2:1634569_at:358:393; Interrogation_Position=510; Antisense; GAAAGCAATGATAACGCCGGAACTG
>probe:Drosophila_2:1634569_at:282:317; Interrogation_Position=525; Antisense; GCCGGAACTGAAACCATTGATCTTA
>probe:Drosophila_2:1634569_at:544:605; Interrogation_Position=542; Antisense; TGATCTTAAGATTCGGCCGCATGTT
>probe:Drosophila_2:1634569_at:414:185; Interrogation_Position=586; Antisense; AACACAAATGCCTTGGAAGCCTTGC
>probe:Drosophila_2:1634569_at:244:127; Interrogation_Position=603; Antisense; AGCCTTGCAGATCCTTGTTCATGAG
>probe:Drosophila_2:1634569_at:711:43; Interrogation_Position=636; Antisense; ATCGAACAGCCGGAACATGAGACAT
>probe:Drosophila_2:1634569_at:530:435; Interrogation_Position=89; Antisense; GAGGTAACCAGAACCACACCCAGAT

Paste this into a BLAST search page for me
GGAAAGACAGCGTCATCTCCGAGCATGCACAGGCCTCCATACGATGGATAGATTGGCACAAACACTTTAACCGAGTTTAACCGAGATGCCGAACCAAAGGTATTTCGAACTGGAGCAGAGCTCGGAGCTCGGAGCGCCTACCAAAAAGAGATTCAAACGGTTGTCCAGATCCTGAGAAAGCAATGATAACGCCGGAACTGGCCGGAACTGAAACCATTGATCTTATGATCTTAAGATTCGGCCGCATGTTAACACAAATGCCTTGGAAGCCTTGCAGCCTTGCAGATCCTTGTTCATGAGATCGAACAGCCGGAACATGAGACATGAGGTAACCAGAACCACACCCAGAT

Full Affymetrix probeset data:

Annotations for 1634569_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720