Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634570_at:

>probe:Drosophila_2:1634570_at:548:635; Interrogation_Position=1104; Antisense; TCGCAAGCAATCTGAATTCTGTGAA
>probe:Drosophila_2:1634570_at:11:67; Interrogation_Position=1211; Antisense; ATGGCAATCCCATTGGTACAACAGA
>probe:Drosophila_2:1634570_at:300:539; Interrogation_Position=1225; Antisense; GGTACAACAGATTATCCGTCGGATG
>probe:Drosophila_2:1634570_at:599:575; Interrogation_Position=1356; Antisense; TGGCGTAACTCCCATTGTGGACGTA
>probe:Drosophila_2:1634570_at:437:555; Interrogation_Position=1374; Antisense; GGACGTAATTCGATCAATGCTGTGT
>probe:Drosophila_2:1634570_at:678:231; Interrogation_Position=1413; Antisense; AATGAACTCCAACCATCGATGGATT
>probe:Drosophila_2:1634570_at:463:441; Interrogation_Position=1430; Antisense; GATGGATTTCGAGGCAGCTGCTCAC
>probe:Drosophila_2:1634570_at:436:353; Interrogation_Position=1443; Antisense; GCAGCTGCTCACTGGAATCCAAGTT
>probe:Drosophila_2:1634570_at:370:585; Interrogation_Position=1455; Antisense; TGGAATCCAAGTTCCGACTCTCCAG
>probe:Drosophila_2:1634570_at:518:403; Interrogation_Position=1470; Antisense; GACTCTCCAGCTATTGGTCAACAAT
>probe:Drosophila_2:1634570_at:250:177; Interrogation_Position=1518; Antisense; AAACGTCACACTACTGGAGAGCCTT
>probe:Drosophila_2:1634570_at:383:75; Interrogation_Position=1535; Antisense; AGAGCCTTAAGGAGCGAGACGATTT
>probe:Drosophila_2:1634570_at:290:421; Interrogation_Position=1550; Antisense; GAGACGATTTGAATTCGGACCAAGA
>probe:Drosophila_2:1634570_at:487:17; Interrogation_Position=1663; Antisense; ATTTCTTTCTAGTGTTTTCCAACAG

Paste this into a BLAST search page for me
TCGCAAGCAATCTGAATTCTGTGAAATGGCAATCCCATTGGTACAACAGAGGTACAACAGATTATCCGTCGGATGTGGCGTAACTCCCATTGTGGACGTAGGACGTAATTCGATCAATGCTGTGTAATGAACTCCAACCATCGATGGATTGATGGATTTCGAGGCAGCTGCTCACGCAGCTGCTCACTGGAATCCAAGTTTGGAATCCAAGTTCCGACTCTCCAGGACTCTCCAGCTATTGGTCAACAATAAACGTCACACTACTGGAGAGCCTTAGAGCCTTAAGGAGCGAGACGATTTGAGACGATTTGAATTCGGACCAAGAATTTCTTTCTAGTGTTTTCCAACAG

Full Affymetrix probeset data:

Annotations for 1634570_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime