FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634572_at:

>probe:Drosophila_2:1634572_at:642:239; Interrogation_Position=1098; Antisense; AATAATTCACCCTTTTCGGCATCAG
>probe:Drosophila_2:1634572_at:554:35; Interrogation_Position=1118; Antisense; ATCAGCTTCGCTTTGGTTTTTAACA
>probe:Drosophila_2:1634572_at:432:123; Interrogation_Position=571; Antisense; AGCCCCAGTTCGAGGTGGACATCAT
>probe:Drosophila_2:1634572_at:219:29; Interrogation_Position=594; Antisense; ATAAAGGGCAACTCTACGCTGTCCT
>probe:Drosophila_2:1634572_at:253:357; Interrogation_Position=710; Antisense; GAACGATAAGGTCTACGCCGTCGCA
>probe:Drosophila_2:1634572_at:532:267; Interrogation_Position=733; Antisense; CAGGCGACGTGCTTGACGGTTACTT
>probe:Drosophila_2:1634572_at:340:289; Interrogation_Position=749; Antisense; CGGTTACTTGTACGACTTGCTGATC
>probe:Drosophila_2:1634572_at:257:403; Interrogation_Position=762; Antisense; GACTTGCTGATCAACTTGCTGGAGG
>probe:Drosophila_2:1634572_at:222:389; Interrogation_Position=813; Antisense; GAAAAACTGTCGGACCTAGCCACTG
>probe:Drosophila_2:1634572_at:667:55; Interrogation_Position=841; Antisense; ATGAGCACACTTCCTACATTGGTCT
>probe:Drosophila_2:1634572_at:137:561; Interrogation_Position=869; Antisense; GGAAAAGCTCTCCAAATTCACTGCC
>probe:Drosophila_2:1634572_at:28:369; Interrogation_Position=904; Antisense; GAATGTTCGTCCCACTTAATCTTAA
>probe:Drosophila_2:1634572_at:617:217; Interrogation_Position=952; Antisense; AAGTTTCTATTGTCTGCTGTCGCAG
>probe:Drosophila_2:1634572_at:517:333; Interrogation_Position=967; Antisense; GCTGTCGCAGTTTCATCACCTAAAA

Paste this into a BLAST search page for me
AATAATTCACCCTTTTCGGCATCAGATCAGCTTCGCTTTGGTTTTTAACAAGCCCCAGTTCGAGGTGGACATCATATAAAGGGCAACTCTACGCTGTCCTGAACGATAAGGTCTACGCCGTCGCACAGGCGACGTGCTTGACGGTTACTTCGGTTACTTGTACGACTTGCTGATCGACTTGCTGATCAACTTGCTGGAGGGAAAAACTGTCGGACCTAGCCACTGATGAGCACACTTCCTACATTGGTCTGGAAAAGCTCTCCAAATTCACTGCCGAATGTTCGTCCCACTTAATCTTAAAAGTTTCTATTGTCTGCTGTCGCAGGCTGTCGCAGTTTCATCACCTAAAA

Full Affymetrix probeset data:

Annotations for 1634572_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720