FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634575_at:

>probe:Drosophila_2:1634575_at:461:297; Interrogation_Position=350; Antisense; CGAATGGATTGTGGCTGCCGGCATT
>probe:Drosophila_2:1634575_at:270:627; Interrogation_Position=365; Antisense; TGCCGGCATTTCGAATCTCAATCAA
>probe:Drosophila_2:1634575_at:509:479; Interrogation_Position=394; Antisense; GTATTCGACGCCATGTTAAGGACTT
>probe:Drosophila_2:1634575_at:341:657; Interrogation_Position=410; Antisense; TAAGGACTTCATCCTGTCCGAGCAA
>probe:Drosophila_2:1634575_at:356:519; Interrogation_Position=468; Antisense; GTGGTACTGCTGAAAACTCCATTGA
>probe:Drosophila_2:1634575_at:2:683; Interrogation_Position=520; Antisense; TATGTTCGGTGAGCCTTAAGCCAGG
>probe:Drosophila_2:1634575_at:98:159; Interrogation_Position=601; Antisense; ACAACTTACTACGTACGGTGACAGT
>probe:Drosophila_2:1634575_at:586:253; Interrogation_Position=638; Antisense; CAAAAAGAACTGTCGCGCTGCCTAT
>probe:Drosophila_2:1634575_at:307:25; Interrogation_Position=693; Antisense; ATATGTGCTGCAGTGCTGGGACGTA
>probe:Drosophila_2:1634575_at:634:223; Interrogation_Position=717; Antisense; AAGGATGCGTGCACCTTTGACTCAG
>probe:Drosophila_2:1634575_at:698:645; Interrogation_Position=738; Antisense; TCAGGTGGGCCGTTGGTGTTCAAAA
>probe:Drosophila_2:1634575_at:138:443; Interrogation_Position=796; Antisense; GATGTGCTAGCAACCGTTATCCTGG
>probe:Drosophila_2:1634575_at:718:631; Interrogation_Position=815; Antisense; TCCTGGCGTCTACACGGATGTTATG
>probe:Drosophila_2:1634575_at:419:547; Interrogation_Position=830; Antisense; GGATGTTATGTACGTGAAGCCTTTT

Paste this into a BLAST search page for me
CGAATGGATTGTGGCTGCCGGCATTTGCCGGCATTTCGAATCTCAATCAAGTATTCGACGCCATGTTAAGGACTTTAAGGACTTCATCCTGTCCGAGCAAGTGGTACTGCTGAAAACTCCATTGATATGTTCGGTGAGCCTTAAGCCAGGACAACTTACTACGTACGGTGACAGTCAAAAAGAACTGTCGCGCTGCCTATATATGTGCTGCAGTGCTGGGACGTAAAGGATGCGTGCACCTTTGACTCAGTCAGGTGGGCCGTTGGTGTTCAAAAGATGTGCTAGCAACCGTTATCCTGGTCCTGGCGTCTACACGGATGTTATGGGATGTTATGTACGTGAAGCCTTTT

Full Affymetrix probeset data:

Annotations for 1634575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720