Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634576_at:

>probe:Drosophila_2:1634576_at:405:357; Interrogation_Position=10007; Antisense; GCAAAATACGAATTTTCTCGTTCGA
>probe:Drosophila_2:1634576_at:79:697; Interrogation_Position=10020; Antisense; TTTCTCGTTCGATTTGCATTAATTT
>probe:Drosophila_2:1634576_at:150:383; Interrogation_Position=10051; Antisense; GAACGGTATTGCTTTCTTTCGTCTA
>probe:Drosophila_2:1634576_at:230:341; Interrogation_Position=10061; Antisense; GCTTTCTTTCGTCTATATTTTGTGT
>probe:Drosophila_2:1634576_at:416:695; Interrogation_Position=10122; Antisense; TTTCCTAACTTAAACAGCCAGACAG
>probe:Drosophila_2:1634576_at:407:155; Interrogation_Position=10143; Antisense; ACAGCAAAACGAAACTGCAAACTTT
>probe:Drosophila_2:1634576_at:449:247; Interrogation_Position=9608; Antisense; AATTGTTAGACCGTACACCGCATCG
>probe:Drosophila_2:1634576_at:322:403; Interrogation_Position=9616; Antisense; GACCGTACACCGCATCGAACCTTTT
>probe:Drosophila_2:1634576_at:422:463; Interrogation_Position=9731; Antisense; GATTCTCATAACTGTTTGATTTAAG
>probe:Drosophila_2:1634576_at:384:33; Interrogation_Position=9804; Antisense; ATCACCAATGGAAACGTATAAGTCT
>probe:Drosophila_2:1634576_at:17:1; Interrogation_Position=9879; Antisense; AGACAGTAACCAGCCAAGTTTACTA
>probe:Drosophila_2:1634576_at:703:73; Interrogation_Position=9912; Antisense; AGGACACTCGACGATCTACGATCTA
>probe:Drosophila_2:1634576_at:315:137; Interrogation_Position=9922; Antisense; ACGATCTACGATCTAAGTTGATGAA
>probe:Drosophila_2:1634576_at:41:175; Interrogation_Position=9983; Antisense; AAACGCACACACTTAGAGAAAACTG

Paste this into a BLAST search page for me
GCAAAATACGAATTTTCTCGTTCGATTTCTCGTTCGATTTGCATTAATTTGAACGGTATTGCTTTCTTTCGTCTAGCTTTCTTTCGTCTATATTTTGTGTTTTCCTAACTTAAACAGCCAGACAGACAGCAAAACGAAACTGCAAACTTTAATTGTTAGACCGTACACCGCATCGGACCGTACACCGCATCGAACCTTTTGATTCTCATAACTGTTTGATTTAAGATCACCAATGGAAACGTATAAGTCTAGACAGTAACCAGCCAAGTTTACTAAGGACACTCGACGATCTACGATCTAACGATCTACGATCTAAGTTGATGAAAAACGCACACACTTAGAGAAAACTG

Full Affymetrix probeset data:

Annotations for 1634576_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime