FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634578_at:

>probe:Drosophila_2:1634578_at:587:225; Interrogation_Position=1004; Antisense; AATACCTGCCGATGCAATCCGGACG
>probe:Drosophila_2:1634578_at:631:511; Interrogation_Position=1042; Antisense; GTGACAAGTCGCAGCCCGCGTGGAA
>probe:Drosophila_2:1634578_at:362:381; Interrogation_Position=1064; Antisense; GAACGACGAGTTCAAGCTGTATCTG
>probe:Drosophila_2:1634578_at:201:333; Interrogation_Position=1079; Antisense; GCTGTATCTGACGTCGAACATCTCG
>probe:Drosophila_2:1634578_at:715:143; Interrogation_Position=1126; Antisense; ACTGCCTCACCGGATTCGTGGAGCG
>probe:Drosophila_2:1634578_at:271:587; Interrogation_Position=1144; Antisense; TGGAGCGCCGCTGCCAGGTGACCAA
>probe:Drosophila_2:1634578_at:571:187; Interrogation_Position=1167; Antisense; AACACCTTCCAGATGACTCACTTTG
>probe:Drosophila_2:1634578_at:46:695; Interrogation_Position=1188; Antisense; TTTGCGGTCATCAAGCGCCAGTGGC
>probe:Drosophila_2:1634578_at:444:555; Interrogation_Position=646; Antisense; GGACGCCGCAGGAAATCTACTTCGA
>probe:Drosophila_2:1634578_at:65:101; Interrogation_Position=670; Antisense; AGAGTCGCGGCAAGTCCTGCAAGAA
>probe:Drosophila_2:1634578_at:143:457; Interrogation_Position=725; Antisense; GATACTGCTGTATCCCGAGGAGGGC
>probe:Drosophila_2:1634578_at:56:75; Interrogation_Position=756; Antisense; AGGACCGCCTCATCCAGTTACTGGA
>probe:Drosophila_2:1634578_at:100:627; Interrogation_Position=813; Antisense; TGCCGCATCGTCGAGTGCTCCGGAA
>probe:Drosophila_2:1634578_at:197:553; Interrogation_Position=875; Antisense; GGAGCAGCAGGGATCCCTCCTGATT

Paste this into a BLAST search page for me
AATACCTGCCGATGCAATCCGGACGGTGACAAGTCGCAGCCCGCGTGGAAGAACGACGAGTTCAAGCTGTATCTGGCTGTATCTGACGTCGAACATCTCGACTGCCTCACCGGATTCGTGGAGCGTGGAGCGCCGCTGCCAGGTGACCAAAACACCTTCCAGATGACTCACTTTGTTTGCGGTCATCAAGCGCCAGTGGCGGACGCCGCAGGAAATCTACTTCGAAGAGTCGCGGCAAGTCCTGCAAGAAGATACTGCTGTATCCCGAGGAGGGCAGGACCGCCTCATCCAGTTACTGGATGCCGCATCGTCGAGTGCTCCGGAAGGAGCAGCAGGGATCCCTCCTGATT

Full Affymetrix probeset data:

Annotations for 1634578_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720