Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634579_at:

>probe:Drosophila_2:1634579_at:468:639; Interrogation_Position=1638; Antisense; TCGTGCTTCAAGACCATTGCCAAGA
>probe:Drosophila_2:1634579_at:189:563; Interrogation_Position=1678; Antisense; GGAATATCGGTAACGCCTGCAAAGT
>probe:Drosophila_2:1634579_at:155:467; Interrogation_Position=1745; Antisense; GTTGGCTGAGGCGTTAGCACTTGCT
>probe:Drosophila_2:1634579_at:256:675; Interrogation_Position=1759; Antisense; TAGCACTTGCTGATCGGTTCTCGAT
>probe:Drosophila_2:1634579_at:235:713; Interrogation_Position=1776; Antisense; TTCTCGATCTCTCTGAACGACATCA
>probe:Drosophila_2:1634579_at:372:165; Interrogation_Position=1827; Antisense; AAATCACCCATGCTGCTGGCTAAGG
>probe:Drosophila_2:1634579_at:277:169; Interrogation_Position=1858; Antisense; AAATGGCCAAGGGTGACTTCAATCC
>probe:Drosophila_2:1634579_at:180:693; Interrogation_Position=1892; Antisense; TTTGAGCCACATGCAACGCGACTTG
>probe:Drosophila_2:1634579_at:617:299; Interrogation_Position=1908; Antisense; CGCGACTTGCGCTTGGTGTTAAACA
>probe:Drosophila_2:1634579_at:597:67; Interrogation_Position=1932; Antisense; ATGGCTGAGAACCTGGACCAGTCCA
>probe:Drosophila_2:1634579_at:527:123; Interrogation_Position=1999; Antisense; AGCGCTTGGGCTACAGTGAACACGA
>probe:Drosophila_2:1634579_at:669:85; Interrogation_Position=2013; Antisense; AGTGAACACGACTCGAGCGCCGTAT
>probe:Drosophila_2:1634579_at:74:125; Interrogation_Position=2028; Antisense; AGCGCCGTATTCGTAAGATCCAGAT
>probe:Drosophila_2:1634579_at:619:105; Interrogation_Position=2182; Antisense; AGAAACGCATAACCCTCACTTATTC

Paste this into a BLAST search page for me
TCGTGCTTCAAGACCATTGCCAAGAGGAATATCGGTAACGCCTGCAAAGTGTTGGCTGAGGCGTTAGCACTTGCTTAGCACTTGCTGATCGGTTCTCGATTTCTCGATCTCTCTGAACGACATCAAAATCACCCATGCTGCTGGCTAAGGAAATGGCCAAGGGTGACTTCAATCCTTTGAGCCACATGCAACGCGACTTGCGCGACTTGCGCTTGGTGTTAAACAATGGCTGAGAACCTGGACCAGTCCAAGCGCTTGGGCTACAGTGAACACGAAGTGAACACGACTCGAGCGCCGTATAGCGCCGTATTCGTAAGATCCAGATAGAAACGCATAACCCTCACTTATTC

Full Affymetrix probeset data:

Annotations for 1634579_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime