FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634580_at:

>probe:Drosophila_2:1634580_at:716:143; Interrogation_Position=106; Antisense; ACTGCCTCCACCCATTCAGAATGGA
>probe:Drosophila_2:1634580_at:450:585; Interrogation_Position=127; Antisense; TGGAGCCATACATACGGACGTCTTT
>probe:Drosophila_2:1634580_at:509:27; Interrogation_Position=134; Antisense; ATACATACGGACGTCTTTGCTCCTT
>probe:Drosophila_2:1634580_at:277:139; Interrogation_Position=140; Antisense; ACGGACGTCTTTGCTCCTTATATAA
>probe:Drosophila_2:1634580_at:8:499; Interrogation_Position=146; Antisense; GTCTTTGCTCCTTATATAAAACAGA
>probe:Drosophila_2:1634580_at:381:365; Interrogation_Position=169; Antisense; GAATCACACTGTAAAACCGTATTGA
>probe:Drosophila_2:1634580_at:236:461; Interrogation_Position=192; Antisense; GATTTATCTTATTTACCCTCTTGAA
>probe:Drosophila_2:1634580_at:400:687; Interrogation_Position=201; Antisense; TATTTACCCTCTTGAAAAGGCCGAT
>probe:Drosophila_2:1634580_at:644:301; Interrogation_Position=207; Antisense; CCCTCTTGAAAAGGCCGATATGCTC
>probe:Drosophila_2:1634580_at:171:475; Interrogation_Position=515; Antisense; GTATGAAACTTGCACCTTTAACTTT
>probe:Drosophila_2:1634580_at:690:177; Interrogation_Position=554; Antisense; AAACATAGGTATTTAATCCGTAGAT
>probe:Drosophila_2:1634580_at:117:655; Interrogation_Position=567; Antisense; TAATCCGTAGATAATTGGCTTACTT
>probe:Drosophila_2:1634580_at:291:257; Interrogation_Position=77; Antisense; CCCCTAATTCCAGACGAAGTTGTCT
>probe:Drosophila_2:1634580_at:698:105; Interrogation_Position=90; Antisense; ACGAAGTTGTCTGAAAACTGCCTCC

Paste this into a BLAST search page for me
ACTGCCTCCACCCATTCAGAATGGATGGAGCCATACATACGGACGTCTTTATACATACGGACGTCTTTGCTCCTTACGGACGTCTTTGCTCCTTATATAAGTCTTTGCTCCTTATATAAAACAGAGAATCACACTGTAAAACCGTATTGAGATTTATCTTATTTACCCTCTTGAATATTTACCCTCTTGAAAAGGCCGATCCCTCTTGAAAAGGCCGATATGCTCGTATGAAACTTGCACCTTTAACTTTAAACATAGGTATTTAATCCGTAGATTAATCCGTAGATAATTGGCTTACTTCCCCTAATTCCAGACGAAGTTGTCTACGAAGTTGTCTGAAAACTGCCTCC

Full Affymetrix probeset data:

Annotations for 1634580_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720