FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634581_at:

>probe:Drosophila_2:1634581_at:597:419; Interrogation_Position=100; Antisense; GAGCACGTCTACAAGTATCCTCCGA
>probe:Drosophila_2:1634581_at:199:149; Interrogation_Position=155; Antisense; ACTTGACGTATAACACCACTGGTGG
>probe:Drosophila_2:1634581_at:10:487; Interrogation_Position=188; Antisense; GTAGTAGTAGCAGATCCTTTCGTTC
>probe:Drosophila_2:1634581_at:466:579; Interrogation_Position=21; Antisense; GGCCATATCAGTGCCACTAACTTTG
>probe:Drosophila_2:1634581_at:62:215; Interrogation_Position=300; Antisense; AAGATCAGGATACCCTGCGGAGTCC
>probe:Drosophila_2:1634581_at:486:599; Interrogation_Position=325; Antisense; TGTCTCCTCCGCTTGATTTGCGAAA
>probe:Drosophila_2:1634581_at:363:389; Interrogation_Position=346; Antisense; GAAACGAATTCCTCAACGCTTGGCG
>probe:Drosophila_2:1634581_at:90:219; Interrogation_Position=371; Antisense; AAGTCAATGGACTCTTGGGCAGCAT
>probe:Drosophila_2:1634581_at:624:679; Interrogation_Position=395; Antisense; TAGTGCATATCTTGTTCACACCCAG
>probe:Drosophila_2:1634581_at:351:157; Interrogation_Position=412; Antisense; ACACCCAGCAGCTCTAATGACGAGA
>probe:Drosophila_2:1634581_at:424:117; Interrogation_Position=459; Antisense; AGCTGAATGGGATGGCCTTCGTCAT
>probe:Drosophila_2:1634581_at:540:269; Interrogation_Position=481; Antisense; CATGGCGACTGCTCATTTTATGCTA
>probe:Drosophila_2:1634581_at:43:33; Interrogation_Position=537; Antisense; ATCAAGGCCATTGCACGATGTTCTT
>probe:Drosophila_2:1634581_at:256:683; Interrogation_Position=76; Antisense; TATGAATTCAACTACTACCAGCCCG

Paste this into a BLAST search page for me
GAGCACGTCTACAAGTATCCTCCGAACTTGACGTATAACACCACTGGTGGGTAGTAGTAGCAGATCCTTTCGTTCGGCCATATCAGTGCCACTAACTTTGAAGATCAGGATACCCTGCGGAGTCCTGTCTCCTCCGCTTGATTTGCGAAAGAAACGAATTCCTCAACGCTTGGCGAAGTCAATGGACTCTTGGGCAGCATTAGTGCATATCTTGTTCACACCCAGACACCCAGCAGCTCTAATGACGAGAAGCTGAATGGGATGGCCTTCGTCATCATGGCGACTGCTCATTTTATGCTAATCAAGGCCATTGCACGATGTTCTTTATGAATTCAACTACTACCAGCCCG

Full Affymetrix probeset data:

Annotations for 1634581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720