FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634582_at:

>probe:Drosophila_2:1634582_at:344:673; Interrogation_Position=100; Antisense; TATAACCGCCGGCTGAAAACACATG
>probe:Drosophila_2:1634582_at:162:389; Interrogation_Position=114; Antisense; GAAAACACATGAGTCCGTACAGCGG
>probe:Drosophila_2:1634582_at:492:329; Interrogation_Position=145; Antisense; GCGTCGTCTGCTGGACAGTTGGCCA
>probe:Drosophila_2:1634582_at:442:171; Interrogation_Position=172; Antisense; AAAGAAGCGCTTCGGTGTCTACCGC
>probe:Drosophila_2:1634582_at:508:297; Interrogation_Position=19; Antisense; CGCACACATGTGACGGAGGCAATAC
>probe:Drosophila_2:1634582_at:627:337; Interrogation_Position=205; Antisense; GCTCTTCTTTTTACTGGGCGCCGGC
>probe:Drosophila_2:1634582_at:94:287; Interrogation_Position=226; Antisense; CGGCCTGGAATTCTCCATGATCAAT
>probe:Drosophila_2:1634582_at:444:397; Interrogation_Position=253; Antisense; GACAGTGGGCGAGACCAATTTCTAC
>probe:Drosophila_2:1634582_at:421:411; Interrogation_Position=265; Antisense; GACCAATTTCTACCGCACTTTTAAG
>probe:Drosophila_2:1634582_at:120:327; Interrogation_Position=337; Antisense; GCGAGCCGCGAATAACACCAACTAA
>probe:Drosophila_2:1634582_at:643:135; Interrogation_Position=357; Antisense; ACTAAGCAAAATGCCCGCCGGAGTT
>probe:Drosophila_2:1634582_at:387:565; Interrogation_Position=36; Antisense; GGCAATACACAAACACGGCACCTTT
>probe:Drosophila_2:1634582_at:643:345; Interrogation_Position=53; Antisense; GCACCTTTGAATCTCGCCTTAAAAT
>probe:Drosophila_2:1634582_at:435:289; Interrogation_Position=539; Antisense; CGGAATCTGCATAACACTGTGTACT

Paste this into a BLAST search page for me
TATAACCGCCGGCTGAAAACACATGGAAAACACATGAGTCCGTACAGCGGGCGTCGTCTGCTGGACAGTTGGCCAAAAGAAGCGCTTCGGTGTCTACCGCCGCACACATGTGACGGAGGCAATACGCTCTTCTTTTTACTGGGCGCCGGCCGGCCTGGAATTCTCCATGATCAATGACAGTGGGCGAGACCAATTTCTACGACCAATTTCTACCGCACTTTTAAGGCGAGCCGCGAATAACACCAACTAAACTAAGCAAAATGCCCGCCGGAGTTGGCAATACACAAACACGGCACCTTTGCACCTTTGAATCTCGCCTTAAAATCGGAATCTGCATAACACTGTGTACT

Full Affymetrix probeset data:

Annotations for 1634582_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720