FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634584_at:

>probe:Drosophila_2:1634584_at:87:607; Interrogation_Position=425; Antisense; TCATCCGTCTTACCAAGGCCTTCGA
>probe:Drosophila_2:1634584_at:128:69; Interrogation_Position=440; Antisense; AGGCCTTCGAGCAATACGGCACCGA
>probe:Drosophila_2:1634584_at:187:29; Interrogation_Position=453; Antisense; ATACGGCACCGACTTCGCAAAGGTA
>probe:Drosophila_2:1634584_at:594:719; Interrogation_Position=497; Antisense; TTCCTCTGGCCGAGCTTCGACTGTA
>probe:Drosophila_2:1634584_at:390:717; Interrogation_Position=512; Antisense; TTCGACTGTACTTCTCCTTCATGTC
>probe:Drosophila_2:1634584_at:599:269; Interrogation_Position=531; Antisense; CATGTCCTCGGCGTTGGAGACAGAT
>probe:Drosophila_2:1634584_at:66:611; Interrogation_Position=555; Antisense; TGACCAACAGGCCATCCATAGATGA
>probe:Drosophila_2:1634584_at:131:445; Interrogation_Position=575; Antisense; GATGATGCTTTGAATCGGCATTCGT
>probe:Drosophila_2:1634584_at:277:289; Interrogation_Position=590; Antisense; CGGCATTCGTGAATTAATCCCACAT
>probe:Drosophila_2:1634584_at:47:237; Interrogation_Position=605; Antisense; AATCCCACATGGACTGTATCTTCCA
>probe:Drosophila_2:1634584_at:293:407; Interrogation_Position=616; Antisense; GACTGTATCTTCCAAGCGCATGGTT
>probe:Drosophila_2:1634584_at:167:209; Interrogation_Position=662; Antisense; AAGCTATTCATTGACCAACGATTGA
>probe:Drosophila_2:1634584_at:572:369; Interrogation_Position=847; Antisense; GTAGGTAGGATTCTCAGTATTCATA
>probe:Drosophila_2:1634584_at:590:689; Interrogation_Position=968; Antisense; TTTGACCACCTCTGTATAATAAAAT

Paste this into a BLAST search page for me
TCATCCGTCTTACCAAGGCCTTCGAAGGCCTTCGAGCAATACGGCACCGAATACGGCACCGACTTCGCAAAGGTATTCCTCTGGCCGAGCTTCGACTGTATTCGACTGTACTTCTCCTTCATGTCCATGTCCTCGGCGTTGGAGACAGATTGACCAACAGGCCATCCATAGATGAGATGATGCTTTGAATCGGCATTCGTCGGCATTCGTGAATTAATCCCACATAATCCCACATGGACTGTATCTTCCAGACTGTATCTTCCAAGCGCATGGTTAAGCTATTCATTGACCAACGATTGAGTAGGTAGGATTCTCAGTATTCATATTTGACCACCTCTGTATAATAAAAT

Full Affymetrix probeset data:

Annotations for 1634584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720