Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634585_at:

>probe:Drosophila_2:1634585_at:428:585; Interrogation_Position=1002; Antisense; TGGCAAGAAGACCACTGCTGCTGCT
>probe:Drosophila_2:1634585_at:613:57; Interrogation_Position=1075; Antisense; ATGATGGCGGTTTTCATATGCCTTC
>probe:Drosophila_2:1634585_at:175:647; Interrogation_Position=1124; Antisense; TCATGCGGCTTTATGGATCCTACTC
>probe:Drosophila_2:1634585_at:339:341; Interrogation_Position=1178; Antisense; GCTTCGGCATACTGAACCTTTTCAG
>probe:Drosophila_2:1634585_at:399:553; Interrogation_Position=1250; Antisense; GGACCTTGACGCTGGTGAAACACAA
>probe:Drosophila_2:1634585_at:71:163; Interrogation_Position=1274; Antisense; AAATTCAGGGATTTCTTGGCTGTCC
>probe:Drosophila_2:1634585_at:542:299; Interrogation_Position=1298; Antisense; CGCCTGGTAAAGTGCCGGATGGTAT
>probe:Drosophila_2:1634585_at:570:539; Interrogation_Position=1318; Antisense; GGTATGCCCACGGATCAGATGGACA
>probe:Drosophila_2:1634585_at:302:159; Interrogation_Position=1340; Antisense; ACAAAAGCGGGTGCTGCTGCGGCCT
>probe:Drosophila_2:1634585_at:721:653; Interrogation_Position=1424; Antisense; TAATCCGGGATGTGGACCAGCCAGA
>probe:Drosophila_2:1634585_at:525:413; Interrogation_Position=1459; Antisense; GACCAGGTGCAACCGGATCCGAGTA
>probe:Drosophila_2:1634585_at:711:573; Interrogation_Position=1490; Antisense; GGCGGTTCCTCAGCTACAAGCAGGA
>probe:Drosophila_2:1634585_at:58:549; Interrogation_Position=1512; Antisense; GGAGGTGTTCACCATTTACAAGCAG
>probe:Drosophila_2:1634585_at:399:159; Interrogation_Position=1529; Antisense; ACAAGCAGTGCGGTGACTCGTCGAG

Paste this into a BLAST search page for me
TGGCAAGAAGACCACTGCTGCTGCTATGATGGCGGTTTTCATATGCCTTCTCATGCGGCTTTATGGATCCTACTCGCTTCGGCATACTGAACCTTTTCAGGGACCTTGACGCTGGTGAAACACAAAAATTCAGGGATTTCTTGGCTGTCCCGCCTGGTAAAGTGCCGGATGGTATGGTATGCCCACGGATCAGATGGACAACAAAAGCGGGTGCTGCTGCGGCCTTAATCCGGGATGTGGACCAGCCAGAGACCAGGTGCAACCGGATCCGAGTAGGCGGTTCCTCAGCTACAAGCAGGAGGAGGTGTTCACCATTTACAAGCAGACAAGCAGTGCGGTGACTCGTCGAG

Full Affymetrix probeset data:

Annotations for 1634585_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime