FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634586_at:

>probe:Drosophila_2:1634586_at:477:101; Interrogation_Position=1020; Antisense; AGACCCTTTACTTTTGCGGCAATGC
>probe:Drosophila_2:1634586_at:645:43; Interrogation_Position=1041; Antisense; ATGCGGCCGATTGTCTACCCTTTAA
>probe:Drosophila_2:1634586_at:649:695; Interrogation_Position=1061; Antisense; TTTAATTCCCACCATGCTACGCAAG
>probe:Drosophila_2:1634586_at:442:243; Interrogation_Position=1142; Antisense; AATATAACCCTTACTGTGCTGGAGA
>probe:Drosophila_2:1634586_at:592:331; Interrogation_Position=1159; Antisense; GCTGGAGAAATACGTTCCCCGATTC
>probe:Drosophila_2:1634586_at:268:463; Interrogation_Position=1179; Antisense; GATTCTTCAATCACGCTCGATTTCT
>probe:Drosophila_2:1634586_at:445:393; Interrogation_Position=1242; Antisense; GAAATAATCGCAAGCCCCACATAGA
>probe:Drosophila_2:1634586_at:128:25; Interrogation_Position=1309; Antisense; ATATGAGTTCTACTACTTCTGCAAG
>probe:Drosophila_2:1634586_at:709:241; Interrogation_Position=1350; Antisense; AATATTTGGCCCTTCAACTCGAGAA
>probe:Drosophila_2:1634586_at:618:175; Interrogation_Position=788; Antisense; AAACCCATCTATATTTCGCTGGTCA
>probe:Drosophila_2:1634586_at:12:719; Interrogation_Position=802; Antisense; TTCGCTGGTCAAGGATCCGATAGAC
>probe:Drosophila_2:1634586_at:484:267; Interrogation_Position=886; Antisense; CATGTATCCTGGTCGTCGGGAGCGA
>probe:Drosophila_2:1634586_at:397:411; Interrogation_Position=909; Antisense; GACCCGACGAGTGGTACCAACTGAG
>probe:Drosophila_2:1634586_at:52:607; Interrogation_Position=964; Antisense; TGAGTGTCTCTTTGTGCAGCATGCA

Paste this into a BLAST search page for me
AGACCCTTTACTTTTGCGGCAATGCATGCGGCCGATTGTCTACCCTTTAATTTAATTCCCACCATGCTACGCAAGAATATAACCCTTACTGTGCTGGAGAGCTGGAGAAATACGTTCCCCGATTCGATTCTTCAATCACGCTCGATTTCTGAAATAATCGCAAGCCCCACATAGAATATGAGTTCTACTACTTCTGCAAGAATATTTGGCCCTTCAACTCGAGAAAAACCCATCTATATTTCGCTGGTCATTCGCTGGTCAAGGATCCGATAGACCATGTATCCTGGTCGTCGGGAGCGAGACCCGACGAGTGGTACCAACTGAGTGAGTGTCTCTTTGTGCAGCATGCA

Full Affymetrix probeset data:

Annotations for 1634586_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720