Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634588_at:

>probe:Drosophila_2:1634588_at:414:553; Interrogation_Position=3596; Antisense; GGAGCTCGACAAACTGGTCCTGCAA
>probe:Drosophila_2:1634588_at:418:629; Interrogation_Position=3613; Antisense; TCCTGCAATCGGTCGACTGGGATGA
>probe:Drosophila_2:1634588_at:53:427; Interrogation_Position=3642; Antisense; GAGATGTACTAGAACGCAGACCAAC
>probe:Drosophila_2:1634588_at:483:347; Interrogation_Position=3676; Antisense; GCAGAAACACTTTGATTCGGAATTT
>probe:Drosophila_2:1634588_at:46:461; Interrogation_Position=3689; Antisense; GATTCGGAATTTTAACACCTTTGCA
>probe:Drosophila_2:1634588_at:184:423; Interrogation_Position=3779; Antisense; GAGAAGTTTTCTGCTACCTCAAATA
>probe:Drosophila_2:1634588_at:622:159; Interrogation_Position=3810; Antisense; ACAACTCATTTCTAACGTGGCGCTG
>probe:Drosophila_2:1634588_at:202:661; Interrogation_Position=3822; Antisense; TAACGTGGCGCTGAGATATAGGAAT
>probe:Drosophila_2:1634588_at:255:311; Interrogation_Position=3940; Antisense; GCCAGAGAAGTTATACACGAAGTTT
>probe:Drosophila_2:1634588_at:264:19; Interrogation_Position=3971; Antisense; ATATAGCCTTTATACATACTCCCCG
>probe:Drosophila_2:1634588_at:532:669; Interrogation_Position=3987; Antisense; TACTCCCCGATCTGCTAAGTATACA
>probe:Drosophila_2:1634588_at:452:677; Interrogation_Position=4060; Antisense; TAGATTTCATAGACGATTCACATGG
>probe:Drosophila_2:1634588_at:308:461; Interrogation_Position=4074; Antisense; GATTCACATGGATCGGCTACGCTAA
>probe:Drosophila_2:1634588_at:691:451; Interrogation_Position=4084; Antisense; GATCGGCTACGCTAAATTAGAGCTG

Paste this into a BLAST search page for me
GGAGCTCGACAAACTGGTCCTGCAATCCTGCAATCGGTCGACTGGGATGAGAGATGTACTAGAACGCAGACCAACGCAGAAACACTTTGATTCGGAATTTGATTCGGAATTTTAACACCTTTGCAGAGAAGTTTTCTGCTACCTCAAATAACAACTCATTTCTAACGTGGCGCTGTAACGTGGCGCTGAGATATAGGAATGCCAGAGAAGTTATACACGAAGTTTATATAGCCTTTATACATACTCCCCGTACTCCCCGATCTGCTAAGTATACATAGATTTCATAGACGATTCACATGGGATTCACATGGATCGGCTACGCTAAGATCGGCTACGCTAAATTAGAGCTG

Full Affymetrix probeset data:

Annotations for 1634588_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime