Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634589_at:

>probe:Drosophila_2:1634589_at:381:409; Interrogation_Position=1285; Antisense; GACGATAGCATTATTCCTGATACTG
>probe:Drosophila_2:1634589_at:476:655; Interrogation_Position=1394; Antisense; TAATCGATGGCAGGCTATCTTCATT
>probe:Drosophila_2:1634589_at:104:685; Interrogation_Position=1409; Antisense; TATCTTCATTTGATGCCGATCCCGA
>probe:Drosophila_2:1634589_at:702:411; Interrogation_Position=1444; Antisense; GACCACGATCCAGAAGACCTTGAAC
>probe:Drosophila_2:1634589_at:411:191; Interrogation_Position=1474; Antisense; AACTTTTCAATTGCCAGCTCCGCAG
>probe:Drosophila_2:1634589_at:333:353; Interrogation_Position=1495; Antisense; GCAGCCAGGTCCTTGGGTAGCAGTA
>probe:Drosophila_2:1634589_at:292:31; Interrogation_Position=1561; Antisense; ATACAAGAGTGCATTGTCGCGCCCC
>probe:Drosophila_2:1634589_at:450:143; Interrogation_Position=1588; Antisense; ACTGCACTCATATCGTCAATGGCTA
>probe:Drosophila_2:1634589_at:373:571; Interrogation_Position=1608; Antisense; GGCTACTGCGAAAACATCAACCCTG
>probe:Drosophila_2:1634589_at:340:495; Interrogation_Position=1632; Antisense; GTCAGTTCCCATTTCAGATGCGTAT
>probe:Drosophila_2:1634589_at:507:447; Interrogation_Position=1648; Antisense; GATGCGTATCTTGAACTGAACCAGG
>probe:Drosophila_2:1634589_at:665:487; Interrogation_Position=1695; Antisense; GTACTACGGGTCGTATATTGCCGCA
>probe:Drosophila_2:1634589_at:621:687; Interrogation_Position=1708; Antisense; TATATTGCCGCAGCTGCACGACGAG
>probe:Drosophila_2:1634589_at:529:53; Interrogation_Position=1742; Antisense; ATGCATCAAATACTTCGCGCACTTC

Paste this into a BLAST search page for me
GACGATAGCATTATTCCTGATACTGTAATCGATGGCAGGCTATCTTCATTTATCTTCATTTGATGCCGATCCCGAGACCACGATCCAGAAGACCTTGAACAACTTTTCAATTGCCAGCTCCGCAGGCAGCCAGGTCCTTGGGTAGCAGTAATACAAGAGTGCATTGTCGCGCCCCACTGCACTCATATCGTCAATGGCTAGGCTACTGCGAAAACATCAACCCTGGTCAGTTCCCATTTCAGATGCGTATGATGCGTATCTTGAACTGAACCAGGGTACTACGGGTCGTATATTGCCGCATATATTGCCGCAGCTGCACGACGAGATGCATCAAATACTTCGCGCACTTC

Full Affymetrix probeset data:

Annotations for 1634589_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime