Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634590_at:

>probe:Drosophila_2:1634590_at:176:67; Interrogation_Position=13; Antisense; ATGGCCTCCGATGCCGGGTTCGCCG
>probe:Drosophila_2:1634590_at:559:43; Interrogation_Position=155; Antisense; ATCCGCACCTGGGAACCGCCGGAGG
>probe:Drosophila_2:1634590_at:627:199; Interrogation_Position=168; Antisense; AACCGCCGGAGGGATGCCGATGGAT
>probe:Drosophila_2:1634590_at:440:625; Interrogation_Position=182; Antisense; TGCCGATGGATCTGCATGTGCCGCA
>probe:Drosophila_2:1634590_at:250:65; Interrogation_Position=187; Antisense; ATGGATCTGCATGTGCCGCAGGGAT
>probe:Drosophila_2:1634590_at:463:545; Interrogation_Position=189; Antisense; GGATCTGCATGTGCCGCAGGGATTC
>probe:Drosophila_2:1634590_at:177:619; Interrogation_Position=194; Antisense; TGCATGTGCCGCAGGGATTCCCCTA
>probe:Drosophila_2:1634590_at:15:63; Interrogation_Position=197; Antisense; ATGTGCCGCAGGGATTCCCCTACTA
>probe:Drosophila_2:1634590_at:66:347; Interrogation_Position=204; Antisense; GCAGGGATTCCCCTACTACAGGTAA
>probe:Drosophila_2:1634590_at:117:285; Interrogation_Position=44; Antisense; CTGCTGCGGCGCATGTCCAGAACCA
>probe:Drosophila_2:1634590_at:29:577; Interrogation_Position=51; Antisense; GGCGCATGTCCAGAACCACTCGATG
>probe:Drosophila_2:1634590_at:142:63; Interrogation_Position=56; Antisense; ATGTCCAGAACCACTCGATGCACCA
>probe:Drosophila_2:1634590_at:252:109; Interrogation_Position=62; Antisense; AGAACCACTCGATGCACCATCCTAT
>probe:Drosophila_2:1634590_at:48:447; Interrogation_Position=72; Antisense; GATGCACCATCCTATACACTCGCAT

Paste this into a BLAST search page for me
ATGGCCTCCGATGCCGGGTTCGCCGATCCGCACCTGGGAACCGCCGGAGGAACCGCCGGAGGGATGCCGATGGATTGCCGATGGATCTGCATGTGCCGCAATGGATCTGCATGTGCCGCAGGGATGGATCTGCATGTGCCGCAGGGATTCTGCATGTGCCGCAGGGATTCCCCTAATGTGCCGCAGGGATTCCCCTACTAGCAGGGATTCCCCTACTACAGGTAACTGCTGCGGCGCATGTCCAGAACCAGGCGCATGTCCAGAACCACTCGATGATGTCCAGAACCACTCGATGCACCAAGAACCACTCGATGCACCATCCTATGATGCACCATCCTATACACTCGCAT

Full Affymetrix probeset data:

Annotations for 1634590_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime