Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634591_at:

>probe:Drosophila_2:1634591_at:167:117; Interrogation_Position=1033; Antisense; AGCTTGTTCGACTTCCAACTGCAGT
>probe:Drosophila_2:1634591_at:333:351; Interrogation_Position=1053; Antisense; GCAGTTCCGCTCGAGAGGATTCTAT
>probe:Drosophila_2:1634591_at:382:463; Interrogation_Position=1070; Antisense; GATTCTATGCCGTATTCTGTTCCTT
>probe:Drosophila_2:1634591_at:234:471; Interrogation_Position=1088; Antisense; GTTCCTTGATTTTTGAGCCTGTCAT
>probe:Drosophila_2:1634591_at:412:341; Interrogation_Position=1135; Antisense; GCTTCTATTGAGCAGGTCCTATCCA
>probe:Drosophila_2:1634591_at:103:81; Interrogation_Position=1148; Antisense; AGGTCCTATCCAGTTCCGAGAGTGG
>probe:Drosophila_2:1634591_at:329:657; Interrogation_Position=1223; Antisense; TAAGTGTCACACTGCCTTTTCTGGA
>probe:Drosophila_2:1634591_at:581:155; Interrogation_Position=690; Antisense; ACAGCGGTACAAGGCCAAGATCGAC
>probe:Drosophila_2:1634591_at:291:97; Interrogation_Position=707; Antisense; AGATCGACAGGCTTGTGGAACGTTT
>probe:Drosophila_2:1634591_at:636:407; Interrogation_Position=753; Antisense; GACGACTAGTAGTCCTGGCGACTTT
>probe:Drosophila_2:1634591_at:128:283; Interrogation_Position=771; Antisense; CGACTTTTTAACTCTGGCCCATGGA
>probe:Drosophila_2:1634591_at:357:427; Interrogation_Position=794; Antisense; GAGATCTTTGGACCACCAACTTTAT
>probe:Drosophila_2:1634591_at:72:715; Interrogation_Position=916; Antisense; TTCTCCACCTCGTTGCAGGATAATC
>probe:Drosophila_2:1634591_at:503:543; Interrogation_Position=933; Antisense; GGATAATCTTCGCTTGGAACATCAA

Paste this into a BLAST search page for me
AGCTTGTTCGACTTCCAACTGCAGTGCAGTTCCGCTCGAGAGGATTCTATGATTCTATGCCGTATTCTGTTCCTTGTTCCTTGATTTTTGAGCCTGTCATGCTTCTATTGAGCAGGTCCTATCCAAGGTCCTATCCAGTTCCGAGAGTGGTAAGTGTCACACTGCCTTTTCTGGAACAGCGGTACAAGGCCAAGATCGACAGATCGACAGGCTTGTGGAACGTTTGACGACTAGTAGTCCTGGCGACTTTCGACTTTTTAACTCTGGCCCATGGAGAGATCTTTGGACCACCAACTTTATTTCTCCACCTCGTTGCAGGATAATCGGATAATCTTCGCTTGGAACATCAA

Full Affymetrix probeset data:

Annotations for 1634591_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime