FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634592_at:

>probe:Drosophila_2:1634592_at:419:373; Interrogation_Position=1017; Antisense; GAAGTACCCTTCTTTGGTCGTGCTC
>probe:Drosophila_2:1634592_at:426:251; Interrogation_Position=1045; Antisense; CAAGGCGACACAACCAGCTGGGAAA
>probe:Drosophila_2:1634592_at:137:121; Interrogation_Position=1060; Antisense; AGCTGGGAAAGCTGCGCTCTGTCCA
>probe:Drosophila_2:1634592_at:518:267; Interrogation_Position=1089; Antisense; CAGGACGACGGAACCATTATGGCCA
>probe:Drosophila_2:1634592_at:569:15; Interrogation_Position=1104; Antisense; ATTATGGCCATCTGTGCCACAGGCA
>probe:Drosophila_2:1634592_at:631:169; Interrogation_Position=1136; Antisense; AAAGGACTCATTGCTCTCGTGGATT
>probe:Drosophila_2:1634592_at:132:561; Interrogation_Position=1169; Antisense; GGAAGCGAACGGAAATCCCTCCATA
>probe:Drosophila_2:1634592_at:22:309; Interrogation_Position=1264; Antisense; CCAGTGTCCCGGCAACAAGTGATAA
>probe:Drosophila_2:1634592_at:635:281; Interrogation_Position=753; Antisense; CTGCGGTCCAAAATCACGGTTTTCG
>probe:Drosophila_2:1634592_at:29:141; Interrogation_Position=768; Antisense; ACGGTTTTCGAGACCAGCGAGCTGA
>probe:Drosophila_2:1634592_at:658:75; Interrogation_Position=889; Antisense; AGGGACCCTTTCACATATGGCTTAG
>probe:Drosophila_2:1634592_at:685:563; Interrogation_Position=913; Antisense; GGAATCGCCGGATCAACTACTTTAC
>probe:Drosophila_2:1634592_at:269:351; Interrogation_Position=951; Antisense; GCAGATTCTGAGTTCCTGTCTGAAT
>probe:Drosophila_2:1634592_at:321:587; Interrogation_Position=991; Antisense; TGGACGAGGACGATGTCTCCCACAT

Paste this into a BLAST search page for me
GAAGTACCCTTCTTTGGTCGTGCTCCAAGGCGACACAACCAGCTGGGAAAAGCTGGGAAAGCTGCGCTCTGTCCACAGGACGACGGAACCATTATGGCCAATTATGGCCATCTGTGCCACAGGCAAAAGGACTCATTGCTCTCGTGGATTGGAAGCGAACGGAAATCCCTCCATACCAGTGTCCCGGCAACAAGTGATAACTGCGGTCCAAAATCACGGTTTTCGACGGTTTTCGAGACCAGCGAGCTGAAGGGACCCTTTCACATATGGCTTAGGGAATCGCCGGATCAACTACTTTACGCAGATTCTGAGTTCCTGTCTGAATTGGACGAGGACGATGTCTCCCACAT

Full Affymetrix probeset data:

Annotations for 1634592_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720