FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634593_at:

>probe:Drosophila_2:1634593_at:648:379; Interrogation_Position=110; Antisense; GAACCCCTTGATCAACAATTTAATT
>probe:Drosophila_2:1634593_at:52:655; Interrogation_Position=130; Antisense; TAATTGTCCATTTTGCAACCATGAA
>probe:Drosophila_2:1634593_at:436:329; Interrogation_Position=16; Antisense; GCTGTAGCCGCGCACAGTGGAAAAA
>probe:Drosophila_2:1634593_at:670:155; Interrogation_Position=198; Antisense; AAATAACTTGTAGGGTGTGCTTGGA
>probe:Drosophila_2:1634593_at:242:531; Interrogation_Position=210; Antisense; GGGTGTGCTTGGAGGATTTTCAAAC
>probe:Drosophila_2:1634593_at:109:191; Interrogation_Position=242; Antisense; AACTTCCTTTCAGAACCTATCGATG
>probe:Drosophila_2:1634593_at:263:201; Interrogation_Position=255; Antisense; AACCTATCGATGTTTACAATGATTG
>probe:Drosophila_2:1634593_at:407:463; Interrogation_Position=275; Antisense; GATTGGGTAGATGCCTGTGAAACAG
>probe:Drosophila_2:1634593_at:551:489; Interrogation_Position=336; Antisense; GTAAAATAAATTGCTAGAGCCCTCT
>probe:Drosophila_2:1634593_at:709:675; Interrogation_Position=350; Antisense; TAGAGCCCTCTAAATTATACCATAA
>probe:Drosophila_2:1634593_at:573:653; Interrogation_Position=442; Antisense; TAAGCTGAACCCATGAAATTCTAAC
>probe:Drosophila_2:1634593_at:151:3; Interrogation_Position=509; Antisense; ATTGCGCAAAGGAGATTCGTAGAGT
>probe:Drosophila_2:1634593_at:236:187; Interrogation_Position=84; Antisense; AACCGCCTCCGAAGAGAAAGAATAT
>probe:Drosophila_2:1634593_at:384:393; Interrogation_Position=99; Antisense; GAAAGAATATTGAACCCCTTGATCA

Paste this into a BLAST search page for me
GAACCCCTTGATCAACAATTTAATTTAATTGTCCATTTTGCAACCATGAAGCTGTAGCCGCGCACAGTGGAAAAAAAATAACTTGTAGGGTGTGCTTGGAGGGTGTGCTTGGAGGATTTTCAAACAACTTCCTTTCAGAACCTATCGATGAACCTATCGATGTTTACAATGATTGGATTGGGTAGATGCCTGTGAAACAGGTAAAATAAATTGCTAGAGCCCTCTTAGAGCCCTCTAAATTATACCATAATAAGCTGAACCCATGAAATTCTAACATTGCGCAAAGGAGATTCGTAGAGTAACCGCCTCCGAAGAGAAAGAATATGAAAGAATATTGAACCCCTTGATCA

Full Affymetrix probeset data:

Annotations for 1634593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720