Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634594_at:

>probe:Drosophila_2:1634594_at:369:691; Interrogation_Position=123; Antisense; TATTGGCCAGGCTGTGGAGTCCGAT
>probe:Drosophila_2:1634594_at:325:51; Interrogation_Position=13; Antisense; ATGCGTTCCGCGATTTTGTTCGGCC
>probe:Drosophila_2:1634594_at:713:293; Interrogation_Position=144; Antisense; CGATGTGCGTGCTAAGCGGCAGTTT
>probe:Drosophila_2:1634594_at:639:623; Interrogation_Position=180; Antisense; TCCCTTTGGCGGATTTGGAGGACCT
>probe:Drosophila_2:1634594_at:554:547; Interrogation_Position=235; Antisense; GGAGGCTTTGGTTATGGACGTCCCT
>probe:Drosophila_2:1634594_at:124:557; Interrogation_Position=250; Antisense; GGACGTCCCTTCTATGGAGGCTATG
>probe:Drosophila_2:1634594_at:53:683; Interrogation_Position=27; Antisense; TTTGTTCGGCCTTATTGTTTGCCTG
>probe:Drosophila_2:1634594_at:17:69; Interrogation_Position=272; Antisense; ATGGCCGTCCCTTCTATGGAGGTTT
>probe:Drosophila_2:1634594_at:668:643; Interrogation_Position=284; Antisense; TCTATGGAGGTTTCGGAAGACCCTT
>probe:Drosophila_2:1634594_at:343:371; Interrogation_Position=299; Antisense; GAAGACCCTTCTACGGAGGCGGCTT
>probe:Drosophila_2:1634594_at:294:691; Interrogation_Position=39; Antisense; TATTGTTTGCCTGGCTTTTAGCCTT
>probe:Drosophila_2:1634594_at:595:707; Interrogation_Position=56; Antisense; TTAGCCTTGTCTTGTCCCTGGAGGA
>probe:Drosophila_2:1634594_at:417:549; Interrogation_Position=75; Antisense; GGAGGAGTCCATCAATCAATCCAAT
>probe:Drosophila_2:1634594_at:131:653; Interrogation_Position=90; Antisense; TCAATCCAATGATCTGTCGTCGGTG

Paste this into a BLAST search page for me
TATTGGCCAGGCTGTGGAGTCCGATATGCGTTCCGCGATTTTGTTCGGCCCGATGTGCGTGCTAAGCGGCAGTTTTCCCTTTGGCGGATTTGGAGGACCTGGAGGCTTTGGTTATGGACGTCCCTGGACGTCCCTTCTATGGAGGCTATGTTTGTTCGGCCTTATTGTTTGCCTGATGGCCGTCCCTTCTATGGAGGTTTTCTATGGAGGTTTCGGAAGACCCTTGAAGACCCTTCTACGGAGGCGGCTTTATTGTTTGCCTGGCTTTTAGCCTTTTAGCCTTGTCTTGTCCCTGGAGGAGGAGGAGTCCATCAATCAATCCAATTCAATCCAATGATCTGTCGTCGGTG

Full Affymetrix probeset data:

Annotations for 1634594_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime