FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634595_at:

>probe:Drosophila_2:1634595_at:26:527; Interrogation_Position=476; Antisense; GGGCAGCTTATCATGTCCGTGGCGT
>probe:Drosophila_2:1634595_at:55:523; Interrogation_Position=494; Antisense; GTGGCGTGCACCTACAAGGCGATAA
>probe:Drosophila_2:1634595_at:463:455; Interrogation_Position=514; Antisense; GATAATGGTCACTCATGCCCTGGAC
>probe:Drosophila_2:1634595_at:609:163; Interrogation_Position=550; Antisense; AAATCGCCGGACGTACAGATACTAT
>probe:Drosophila_2:1634595_at:559:191; Interrogation_Position=587; Antisense; AACTTAGGCGATGGTCCGCGGCGTC
>probe:Drosophila_2:1634595_at:139:375; Interrogation_Position=646; Antisense; GAAGAGCACCGTGCGTGGTCGCAAA
>probe:Drosophila_2:1634595_at:345:33; Interrogation_Position=700; Antisense; ATCAAATCGCCCAATCTAAACACAG
>probe:Drosophila_2:1634595_at:29:259; Interrogation_Position=720; Antisense; CACAGTTTTTCTATGCTTTCGATCA
>probe:Drosophila_2:1634595_at:132:363; Interrogation_Position=747; Antisense; GAATTAGCCCACAAAACACGCGTAA
>probe:Drosophila_2:1634595_at:7:421; Interrogation_Position=833; Antisense; GAGCAGTTTACGCTTTACTAGAAAT
>probe:Drosophila_2:1634595_at:73:213; Interrogation_Position=870; Antisense; AAGAGCAGAGCCAACACGTACACAC
>probe:Drosophila_2:1634595_at:236:17; Interrogation_Position=906; Antisense; ATTTTCAAATTTTGGCGCCTCGCGA
>probe:Drosophila_2:1634595_at:363:323; Interrogation_Position=920; Antisense; GCGCCTCGCGACAATCGATTAACGG
>probe:Drosophila_2:1634595_at:279:127; Interrogation_Position=962; Antisense; AGCCAATCGTATGAATTCCACCTCT

Paste this into a BLAST search page for me
GGGCAGCTTATCATGTCCGTGGCGTGTGGCGTGCACCTACAAGGCGATAAGATAATGGTCACTCATGCCCTGGACAAATCGCCGGACGTACAGATACTATAACTTAGGCGATGGTCCGCGGCGTCGAAGAGCACCGTGCGTGGTCGCAAAATCAAATCGCCCAATCTAAACACAGCACAGTTTTTCTATGCTTTCGATCAGAATTAGCCCACAAAACACGCGTAAGAGCAGTTTACGCTTTACTAGAAATAAGAGCAGAGCCAACACGTACACACATTTTCAAATTTTGGCGCCTCGCGAGCGCCTCGCGACAATCGATTAACGGAGCCAATCGTATGAATTCCACCTCT

Full Affymetrix probeset data:

Annotations for 1634595_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720