Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634599_s_at:

>probe:Drosophila_2:1634599_s_at:717:239; Interrogation_Position=122; Antisense; AATCACAGCAACTACAGAGCCAGCA
>probe:Drosophila_2:1634599_s_at:454:187; Interrogation_Position=200; Antisense; AACAGCAAACACTACAACCACCAGT
>probe:Drosophila_2:1634599_s_at:47:203; Interrogation_Position=215; Antisense; AACCACCAGTAGAACATCTCAAGGA
>probe:Drosophila_2:1634599_s_at:653:167; Interrogation_Position=245; Antisense; AAATGATGACCGATAGGGCAAGCGA
>probe:Drosophila_2:1634599_s_at:31:83; Interrogation_Position=259; Antisense; AGGGCAAGCGAGAAGCAACAGCAGC
>probe:Drosophila_2:1634599_s_at:554:193; Interrogation_Position=315; Antisense; AACCAACGATCAAGACGTGGACGAT
>probe:Drosophila_2:1634599_s_at:228:355; Interrogation_Position=380; Antisense; GCACCATTGTGGAGGACAGCGATGC
>probe:Drosophila_2:1634599_s_at:57:619; Interrogation_Position=412; Antisense; TGCAGCAGTTGTCGACGAGCCGAAC
>probe:Drosophila_2:1634599_s_at:244:237; Interrogation_Position=445; Antisense; AATCAGCAAGAACAACCGCCGACAT
>probe:Drosophila_2:1634599_s_at:27:35; Interrogation_Position=471; Antisense; ATCATCTCCCCACAAGGATCGGGAA
>probe:Drosophila_2:1634599_s_at:688:159; Interrogation_Position=482; Antisense; ACAAGGATCGGGAACACGTCACATA
>probe:Drosophila_2:1634599_s_at:723:567; Interrogation_Position=56; Antisense; GGCAGCAGTCGCATTTCGGAGCATC
>probe:Drosophila_2:1634599_s_at:359:87; Interrogation_Position=62; Antisense; AGTCGCATTTCGGAGCATCAGAGGA
>probe:Drosophila_2:1634599_s_at:32:609; Interrogation_Position=87; Antisense; TGAGGATCTAGAGCAGAAACAGCAA

Paste this into a BLAST search page for me
AATCACAGCAACTACAGAGCCAGCAAACAGCAAACACTACAACCACCAGTAACCACCAGTAGAACATCTCAAGGAAAATGATGACCGATAGGGCAAGCGAAGGGCAAGCGAGAAGCAACAGCAGCAACCAACGATCAAGACGTGGACGATGCACCATTGTGGAGGACAGCGATGCTGCAGCAGTTGTCGACGAGCCGAACAATCAGCAAGAACAACCGCCGACATATCATCTCCCCACAAGGATCGGGAAACAAGGATCGGGAACACGTCACATAGGCAGCAGTCGCATTTCGGAGCATCAGTCGCATTTCGGAGCATCAGAGGATGAGGATCTAGAGCAGAAACAGCAA

Full Affymetrix probeset data:

Annotations for 1634599_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime