FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634600_at:

>probe:Drosophila_2:1634600_at:506:665; Interrogation_Position=1010; Antisense; TACCATTCATGGCATTTGACCGATC
>probe:Drosophila_2:1634600_at:492:569; Interrogation_Position=1020; Antisense; GGCATTTGACCGATCGACTGAATTT
>probe:Drosophila_2:1634600_at:32:607; Interrogation_Position=1050; Antisense; TGATCGATCAATTTCTCAGTGACTC
>probe:Drosophila_2:1634600_at:555:665; Interrogation_Position=1126; Antisense; TAGACGGCTGAGGAGACACGGTTTA
>probe:Drosophila_2:1634600_at:719:25; Interrogation_Position=1150; Antisense; ATAGACTTAGTCTTGGTCCTTGCCA
>probe:Drosophila_2:1634600_at:557:535; Interrogation_Position=1164; Antisense; GGTCCTTGCCAGAGACTATAATGTA
>probe:Drosophila_2:1634600_at:416:343; Interrogation_Position=1198; Antisense; GCTTAATATAGCTTCGTTCATCCAC
>probe:Drosophila_2:1634600_at:574:139; Interrogation_Position=632; Antisense; ACGTGAACGTCGCTTTGGCATCTTG
>probe:Drosophila_2:1634600_at:610:569; Interrogation_Position=648; Antisense; GGCATCTTGTCCAAGTGCAAGCACA
>probe:Drosophila_2:1634600_at:141:577; Interrogation_Position=699; Antisense; TGGCGTCAGGCCCATCAATTTGAGG
>probe:Drosophila_2:1634600_at:595:19; Interrogation_Position=716; Antisense; ATTTGAGGCCACTGTGACGCGTGGT
>probe:Drosophila_2:1634600_at:625:597; Interrogation_Position=888; Antisense; TGTCCCTTTGGAAACAAGTGCTTCT
>probe:Drosophila_2:1634600_at:721:665; Interrogation_Position=912; Antisense; TACAGGCACCATCGTCGTTGTGACG
>probe:Drosophila_2:1634600_at:653:233; Interrogation_Position=954; Antisense; AATGCCGTCAATTCAGACTGATGGC

Paste this into a BLAST search page for me
TACCATTCATGGCATTTGACCGATCGGCATTTGACCGATCGACTGAATTTTGATCGATCAATTTCTCAGTGACTCTAGACGGCTGAGGAGACACGGTTTAATAGACTTAGTCTTGGTCCTTGCCAGGTCCTTGCCAGAGACTATAATGTAGCTTAATATAGCTTCGTTCATCCACACGTGAACGTCGCTTTGGCATCTTGGGCATCTTGTCCAAGTGCAAGCACATGGCGTCAGGCCCATCAATTTGAGGATTTGAGGCCACTGTGACGCGTGGTTGTCCCTTTGGAAACAAGTGCTTCTTACAGGCACCATCGTCGTTGTGACGAATGCCGTCAATTCAGACTGATGGC

Full Affymetrix probeset data:

Annotations for 1634600_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720