FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634601_at:

>probe:Drosophila_2:1634601_at:393:667; Interrogation_Position=1482; Antisense; TACAGACTGCGAGCCTTATAAGCCA
>probe:Drosophila_2:1634601_at:237:1; Interrogation_Position=1539; Antisense; AGGGTTCCTGGTATCGTGGCAAAGT
>probe:Drosophila_2:1634601_at:362:95; Interrogation_Position=1569; Antisense; AGATTATAGTTGTTCCACGGCAGCA
>probe:Drosophila_2:1634601_at:413:567; Interrogation_Position=1587; Antisense; GGCAGCAGACAAAGTACCGGGTAAT
>probe:Drosophila_2:1634601_at:401:527; Interrogation_Position=1605; Antisense; GGGTAATGTACCTCGATTACACGAA
>probe:Drosophila_2:1634601_at:652:457; Interrogation_Position=1652; Antisense; GATATCCGTCGCTATCCATTAGACT
>probe:Drosophila_2:1634601_at:42:599; Interrogation_Position=1688; Antisense; TGTGCCACAAACCTTTGCGTGATTG
>probe:Drosophila_2:1634601_at:376:329; Interrogation_Position=1704; Antisense; GCGTGATTGACGAATTCCCGCACAA
>probe:Drosophila_2:1634601_at:239:357; Interrogation_Position=1723; Antisense; GCACAACCCGAATGCAGCACAGGTT
>probe:Drosophila_2:1634601_at:164:113; Interrogation_Position=1738; Antisense; AGCACAGGTTTCCTATCTGGCTGAG
>probe:Drosophila_2:1634601_at:305:287; Interrogation_Position=1754; Antisense; CTGGCTGAGGTTTTGAAGGTCCATC
>probe:Drosophila_2:1634601_at:394:223; Interrogation_Position=1769; Antisense; AAGGTCCATCAGTCAGTTCATATTG
>probe:Drosophila_2:1634601_at:265:237; Interrogation_Position=1830; Antisense; AATCGGGAAGTCTTATTCAGAAGCT
>probe:Drosophila_2:1634601_at:117:235; Interrogation_Position=1883; Antisense; AATGCCATTTACTTGACACCACAAC

Paste this into a BLAST search page for me
TACAGACTGCGAGCCTTATAAGCCAAGGGTTCCTGGTATCGTGGCAAAGTAGATTATAGTTGTTCCACGGCAGCAGGCAGCAGACAAAGTACCGGGTAATGGGTAATGTACCTCGATTACACGAAGATATCCGTCGCTATCCATTAGACTTGTGCCACAAACCTTTGCGTGATTGGCGTGATTGACGAATTCCCGCACAAGCACAACCCGAATGCAGCACAGGTTAGCACAGGTTTCCTATCTGGCTGAGCTGGCTGAGGTTTTGAAGGTCCATCAAGGTCCATCAGTCAGTTCATATTGAATCGGGAAGTCTTATTCAGAAGCTAATGCCATTTACTTGACACCACAAC

Full Affymetrix probeset data:

Annotations for 1634601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720