FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634604_at:

>probe:Drosophila_2:1634604_at:594:295; Interrogation_Position=2336; Antisense; CGACATTTCCGCACAGATGGCCTGT
>probe:Drosophila_2:1634604_at:514:285; Interrogation_Position=2364; Antisense; CTGAGCGATCTCATTGACGTGGTGC
>probe:Drosophila_2:1634604_at:713:339; Interrogation_Position=2405; Antisense; GCTTTTCCGCGAACCAAACGAGGTG
>probe:Drosophila_2:1634604_at:418:79; Interrogation_Position=2434; Antisense; AGGTGCTCTCTTGGCTTAAGCTGCA
>probe:Drosophila_2:1634604_at:379:371; Interrogation_Position=2465; Antisense; GAAGGCCATGCTGAACGCGTCGCTC
>probe:Drosophila_2:1634604_at:200:201; Interrogation_Position=2478; Antisense; AACGCGTCGCTCATGGAGATCACAG
>probe:Drosophila_2:1634604_at:302:655; Interrogation_Position=2566; Antisense; TAATCAGGGCGTTGTTCCAGGATAC
>probe:Drosophila_2:1634604_at:331:627; Interrogation_Position=2581; Antisense; TCCAGGATACGGATTGGCGGGCCAA
>probe:Drosophila_2:1634604_at:292:523; Interrogation_Position=2599; Antisense; GGGCCAAGGCCATTACGCAGATTGT
>probe:Drosophila_2:1634604_at:370:323; Interrogation_Position=2629; Antisense; GCGCGTGCGCCTTTTTTGCGAGCGA
>probe:Drosophila_2:1634604_at:93:469; Interrogation_Position=2659; Antisense; GTTGAACGGCGGATAGACATCACAT
>probe:Drosophila_2:1634604_at:509:63; Interrogation_Position=2725; Antisense; ATGTGTCCTTACTTTAATTCCTTGA
>probe:Drosophila_2:1634604_at:722:9; Interrogation_Position=2796; Antisense; ATTCTCCGAATGGTTTCTGTTGTAC
>probe:Drosophila_2:1634604_at:683:719; Interrogation_Position=2858; Antisense; TTCCCGCAACGCAACACAATATTTA

Paste this into a BLAST search page for me
CGACATTTCCGCACAGATGGCCTGTCTGAGCGATCTCATTGACGTGGTGCGCTTTTCCGCGAACCAAACGAGGTGAGGTGCTCTCTTGGCTTAAGCTGCAGAAGGCCATGCTGAACGCGTCGCTCAACGCGTCGCTCATGGAGATCACAGTAATCAGGGCGTTGTTCCAGGATACTCCAGGATACGGATTGGCGGGCCAAGGGCCAAGGCCATTACGCAGATTGTGCGCGTGCGCCTTTTTTGCGAGCGAGTTGAACGGCGGATAGACATCACATATGTGTCCTTACTTTAATTCCTTGAATTCTCCGAATGGTTTCTGTTGTACTTCCCGCAACGCAACACAATATTTA

Full Affymetrix probeset data:

Annotations for 1634604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720