FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634605_at:

>probe:Drosophila_2:1634605_at:721:305; Interrogation_Position=210; Antisense; CCTGGGACTGGGTTGTGGCTACAAT
>probe:Drosophila_2:1634605_at:61:235; Interrogation_Position=268; Antisense; AATGCCCAGGAGAACCATCAGCCGG
>probe:Drosophila_2:1634605_at:711:315; Interrogation_Position=288; Antisense; GCCGGTGGAATTCTATCGCGTCGAA
>probe:Drosophila_2:1634605_at:465:73; Interrogation_Position=29; Antisense; AGGAAGCTGTAATTTCTGCCGCGGC
>probe:Drosophila_2:1634605_at:433:635; Interrogation_Position=308; Antisense; TCGAAATGCTTGGATCCGCGGGAGT
>probe:Drosophila_2:1634605_at:117:189; Interrogation_Position=338; Antisense; AACAGGCTTTGCTTTCGCAATTCCG
>probe:Drosophila_2:1634605_at:675:555; Interrogation_Position=369; Antisense; GGACTGCATCAATGCCTACGATGGA
>probe:Drosophila_2:1634605_at:243:671; Interrogation_Position=385; Antisense; TACGATGGACCTGAATGCGACGATG
>probe:Drosophila_2:1634605_at:502:419; Interrogation_Position=412; Antisense; GAGCAGAACGTCTCAATCATCTTGA
>probe:Drosophila_2:1634605_at:366:37; Interrogation_Position=427; Antisense; ATCATCTTGAATGGCACCGAATCGG
>probe:Drosophila_2:1634605_at:396:165; Interrogation_Position=489; Antisense; AAATCATTTGTCAAGGGTCCTCAGC
>probe:Drosophila_2:1634605_at:118:537; Interrogation_Position=504; Antisense; GGTCCTCAGCTTTTTCTATTTGTGT
>probe:Drosophila_2:1634605_at:660:359; Interrogation_Position=68; Antisense; GCAACGAGTCGCGAAGTATCATCAA
>probe:Drosophila_2:1634605_at:34:37; Interrogation_Position=85; Antisense; ATCATCAATCGAGGTGACTCCTTCC

Paste this into a BLAST search page for me
CCTGGGACTGGGTTGTGGCTACAATAATGCCCAGGAGAACCATCAGCCGGGCCGGTGGAATTCTATCGCGTCGAAAGGAAGCTGTAATTTCTGCCGCGGCTCGAAATGCTTGGATCCGCGGGAGTAACAGGCTTTGCTTTCGCAATTCCGGGACTGCATCAATGCCTACGATGGATACGATGGACCTGAATGCGACGATGGAGCAGAACGTCTCAATCATCTTGAATCATCTTGAATGGCACCGAATCGGAAATCATTTGTCAAGGGTCCTCAGCGGTCCTCAGCTTTTTCTATTTGTGTGCAACGAGTCGCGAAGTATCATCAAATCATCAATCGAGGTGACTCCTTCC

Full Affymetrix probeset data:

Annotations for 1634605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720