FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634607_at:

>probe:Drosophila_2:1634607_at:419:603; Interrogation_Position=1039; Antisense; TGTTCCTTATCACTTTTCCTGGCAG
>probe:Drosophila_2:1634607_at:32:719; Interrogation_Position=1054; Antisense; TTCCTGGCAGGCGTTGTCATCGTGA
>probe:Drosophila_2:1634607_at:450:653; Interrogation_Position=1134; Antisense; TAATTTACTGGTCATTGCCCTTCTA
>probe:Drosophila_2:1634607_at:545:625; Interrogation_Position=1149; Antisense; TGCCCTTCTAATGCTGCTATTCGAA
>probe:Drosophila_2:1634607_at:96:441; Interrogation_Position=1222; Antisense; GAGGCCTTTAGCATAGCCCACAAGG
>probe:Drosophila_2:1634607_at:467:341; Interrogation_Position=1253; Antisense; GCTTAGCTGGCATCCTAATCGTAGA
>probe:Drosophila_2:1634607_at:40:423; Interrogation_Position=1276; Antisense; GAGCAATTGCTCCAGTTGGGTCTGC
>probe:Drosophila_2:1634607_at:642:701; Interrogation_Position=1301; Antisense; TTTTGGCCACCTTTGAGCACTACAT
>probe:Drosophila_2:1634607_at:677:419; Interrogation_Position=1315; Antisense; GAGCACTACATCACTGTTTCTGTGT
>probe:Drosophila_2:1634607_at:450:279; Interrogation_Position=1420; Antisense; CTCTACGAGTGCCTGTTGAAGTTCA
>probe:Drosophila_2:1634607_at:94:301; Interrogation_Position=885; Antisense; CGCCGTGTCCTTGAGCTATAATCGA
>probe:Drosophila_2:1634607_at:369:419; Interrogation_Position=908; Antisense; GAGCATTTGTGGTCGTCAGTTGGCA
>probe:Drosophila_2:1634607_at:270:467; Interrogation_Position=926; Antisense; GTTGGCATGGCCTCGAATGCGATAT
>probe:Drosophila_2:1634607_at:108:195; Interrogation_Position=952; Antisense; AACTGCATGTACTGGCTGGCATTCG

Paste this into a BLAST search page for me
TGTTCCTTATCACTTTTCCTGGCAGTTCCTGGCAGGCGTTGTCATCGTGATAATTTACTGGTCATTGCCCTTCTATGCCCTTCTAATGCTGCTATTCGAAGAGGCCTTTAGCATAGCCCACAAGGGCTTAGCTGGCATCCTAATCGTAGAGAGCAATTGCTCCAGTTGGGTCTGCTTTTGGCCACCTTTGAGCACTACATGAGCACTACATCACTGTTTCTGTGTCTCTACGAGTGCCTGTTGAAGTTCACGCCGTGTCCTTGAGCTATAATCGAGAGCATTTGTGGTCGTCAGTTGGCAGTTGGCATGGCCTCGAATGCGATATAACTGCATGTACTGGCTGGCATTCG

Full Affymetrix probeset data:

Annotations for 1634607_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720