Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634608_at:

>probe:Drosophila_2:1634608_at:710:379; Interrogation_Position=189; Antisense; GAACGAGGCTTTCAGGGATCTCACT
>probe:Drosophila_2:1634608_at:101:81; Interrogation_Position=222; Antisense; AGTGTGCCATTTATTCCTAACCGAA
>probe:Drosophila_2:1634608_at:103:587; Interrogation_Position=260; Antisense; TGGACACCTATCAGCTTTCGGAGAT
>probe:Drosophila_2:1634608_at:694:175; Interrogation_Position=292; Antisense; AAACGCCTTAAGCTTCTGGATCTGC
>probe:Drosophila_2:1634608_at:268:227; Interrogation_Position=341; Antisense; AAGGCTACCAGTACACTCCGGATTG
>probe:Drosophila_2:1634608_at:556:463; Interrogation_Position=361; Antisense; GATTGTGACCTTGCAGCTCGATTTG
>probe:Drosophila_2:1634608_at:570:637; Interrogation_Position=378; Antisense; TCGATTTGTAGTCCAGCGCCAGAAA
>probe:Drosophila_2:1634608_at:663:97; Interrogation_Position=457; Antisense; AGATGCCAAACCGTGCTCATGGAAA
>probe:Drosophila_2:1634608_at:121:531; Interrogation_Position=511; Antisense; GGGTATCGAAGCAAAGTCTCCATGG
>probe:Drosophila_2:1634608_at:138:603; Interrogation_Position=548; Antisense; TGTTCTCGGTACTGTTGTCCACCAA
>probe:Drosophila_2:1634608_at:221:597; Interrogation_Position=563; Antisense; TGTCCACCAACCATGAGCTTTCTAT
>probe:Drosophila_2:1634608_at:124:281; Interrogation_Position=658; Antisense; GCTAGAGTTACTCCGTTCCGAACGA
>probe:Drosophila_2:1634608_at:623:385; Interrogation_Position=681; Antisense; GAACATTGATGACCTAATCTCCGAT
>probe:Drosophila_2:1634608_at:292:283; Interrogation_Position=699; Antisense; CTCCGATTTGGATGTCTGTGCTAAG

Paste this into a BLAST search page for me
GAACGAGGCTTTCAGGGATCTCACTAGTGTGCCATTTATTCCTAACCGAATGGACACCTATCAGCTTTCGGAGATAAACGCCTTAAGCTTCTGGATCTGCAAGGCTACCAGTACACTCCGGATTGGATTGTGACCTTGCAGCTCGATTTGTCGATTTGTAGTCCAGCGCCAGAAAAGATGCCAAACCGTGCTCATGGAAAGGGTATCGAAGCAAAGTCTCCATGGTGTTCTCGGTACTGTTGTCCACCAATGTCCACCAACCATGAGCTTTCTATGCTAGAGTTACTCCGTTCCGAACGAGAACATTGATGACCTAATCTCCGATCTCCGATTTGGATGTCTGTGCTAAG

Full Affymetrix probeset data:

Annotations for 1634608_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime