FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634609_at:

>probe:Drosophila_2:1634609_at:457:665; Interrogation_Position=253; Antisense; TACAGTCCTGTAGTTTCGCATAAGA
>probe:Drosophila_2:1634609_at:86:205; Interrogation_Position=325; Antisense; AAGCCCATGTTTCCGATGAACCTAA
>probe:Drosophila_2:1634609_at:669:655; Interrogation_Position=351; Antisense; TAATGTATTACTCCACTCACTGGGC
>probe:Drosophila_2:1634609_at:115:305; Interrogation_Position=512; Antisense; CCGGGATTCCTCAGTTCCAAATAAT
>probe:Drosophila_2:1634609_at:675:423; Interrogation_Position=569; Antisense; GAGAAAGCGCCAATATGTGTCACAT
>probe:Drosophila_2:1634609_at:456:419; Interrogation_Position=595; Antisense; GAGCTTCTAAACTCCATTCAGCGGT
>probe:Drosophila_2:1634609_at:158:259; Interrogation_Position=613; Antisense; CAGCGGTCTCCCTGCGTTAAAATTA
>probe:Drosophila_2:1634609_at:258:241; Interrogation_Position=639; Antisense; AATACCGTTCGACGTACAGGGCGAG
>probe:Drosophila_2:1634609_at:86:575; Interrogation_Position=658; Antisense; GGCGAGGTTTTCTTTGGCTTGTCAA
>probe:Drosophila_2:1634609_at:171:43; Interrogation_Position=696; Antisense; ATCGCTGCTTATGATGGATCCTGCC
>probe:Drosophila_2:1634609_at:526:283; Interrogation_Position=716; Antisense; CTGCCTTTCATCAGTGCACGAATTT
>probe:Drosophila_2:1634609_at:319:63; Interrogation_Position=761; Antisense; ATGTGCAGTCCTTAAACAGCGCGTC
>probe:Drosophila_2:1634609_at:125:189; Interrogation_Position=775; Antisense; AACAGCGCGTCTTTATCCTTTGAGA
>probe:Drosophila_2:1634609_at:359:411; Interrogation_Position=798; Antisense; GACGCTCCAGGGATTTCTATCTTGA

Paste this into a BLAST search page for me
TACAGTCCTGTAGTTTCGCATAAGAAAGCCCATGTTTCCGATGAACCTAATAATGTATTACTCCACTCACTGGGCCCGGGATTCCTCAGTTCCAAATAATGAGAAAGCGCCAATATGTGTCACATGAGCTTCTAAACTCCATTCAGCGGTCAGCGGTCTCCCTGCGTTAAAATTAAATACCGTTCGACGTACAGGGCGAGGGCGAGGTTTTCTTTGGCTTGTCAAATCGCTGCTTATGATGGATCCTGCCCTGCCTTTCATCAGTGCACGAATTTATGTGCAGTCCTTAAACAGCGCGTCAACAGCGCGTCTTTATCCTTTGAGAGACGCTCCAGGGATTTCTATCTTGA

Full Affymetrix probeset data:

Annotations for 1634609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720