Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634610_at:

>probe:Drosophila_2:1634610_at:249:643; Interrogation_Position=1035; Antisense; TCTCACTTCCATTATTCGTCGCTAA
>probe:Drosophila_2:1634610_at:263:9; Interrogation_Position=1048; Antisense; ATTCGTCGCTAATCAAACGCTCTCT
>probe:Drosophila_2:1634610_at:202:339; Interrogation_Position=1066; Antisense; GCTCTCTTCACTCTTTTAGCTGATT
>probe:Drosophila_2:1634610_at:309:513; Interrogation_Position=623; Antisense; GTGATATACGACCACCACTAGAGAT
>probe:Drosophila_2:1634610_at:60:187; Interrogation_Position=663; Antisense; AACACTTAGGCACACATAGGGAGAT
>probe:Drosophila_2:1634610_at:326:527; Interrogation_Position=725; Antisense; GGGACGAAGCGCAAGCTTATCTTTT
>probe:Drosophila_2:1634610_at:505:703; Interrogation_Position=741; Antisense; TTATCTTTTCGCTTTTCGAGAACGC
>probe:Drosophila_2:1634610_at:295:263; Interrogation_Position=815; Antisense; CAGACATCGGCTGTTTAACAAACAC
>probe:Drosophila_2:1634610_at:414:365; Interrogation_Position=879; Antisense; GAATATCAGCCTTTGGTTCTTCTTT
>probe:Drosophila_2:1634610_at:536:471; Interrogation_Position=894; Antisense; GTTCTTCTTTCCTTTGCACATGTGC
>probe:Drosophila_2:1634610_at:78:357; Interrogation_Position=909; Antisense; GCACATGTGCCTGGAAAATATCCTT
>probe:Drosophila_2:1634610_at:487:243; Interrogation_Position=925; Antisense; AATATCCTTACGAACACACTCCCAT
>probe:Drosophila_2:1634610_at:189:135; Interrogation_Position=950; Antisense; ACGCATACGCATACGAACGACAAGC
>probe:Drosophila_2:1634610_at:383:395; Interrogation_Position=979; Antisense; GAAATTTTTGTTCCCTTGCTCTTTG

Paste this into a BLAST search page for me
TCTCACTTCCATTATTCGTCGCTAAATTCGTCGCTAATCAAACGCTCTCTGCTCTCTTCACTCTTTTAGCTGATTGTGATATACGACCACCACTAGAGATAACACTTAGGCACACATAGGGAGATGGGACGAAGCGCAAGCTTATCTTTTTTATCTTTTCGCTTTTCGAGAACGCCAGACATCGGCTGTTTAACAAACACGAATATCAGCCTTTGGTTCTTCTTTGTTCTTCTTTCCTTTGCACATGTGCGCACATGTGCCTGGAAAATATCCTTAATATCCTTACGAACACACTCCCATACGCATACGCATACGAACGACAAGCGAAATTTTTGTTCCCTTGCTCTTTG

Full Affymetrix probeset data:

Annotations for 1634610_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime